Labshake search
Citations for Qiagen :
451 - 500 of 1519 citations for ETS Related Transcription Factor Elf 3 ELF3 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... and first strand cDNA was synthesized using Quantitect reverse transcription kit (Qiagen, Hilden, Germany). Quantitative reverse transcription PCR (qRT-PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was prepared from 500ng of total RNA using QuantiTect Reverse Transcription Kit (Qiagen). SYBR green (see primers list ...
-
bioRxiv - Cell Biology 2021Quote: ... First strand cDNA synthesis was carried out using the QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1000 ng of RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and converted to cDNA using a QuantiTect® Reverse Transcription Kit (QIAGEN, Hilden, Germany). qRT-PCR of VL30 and γ-RVV mRNA was premised on the same primer/probe sets that were described above ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was first reverse-transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesised from 1g total RNA using the QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Cleaned-up RNA (0.5 µg) was reverse transcribed with Omniscript Reverse Transcription kit (Qiagen) using oligo dT primers in a 20 µL reaction volume ...
-
bioRxiv - Molecular Biology 2020Quote: ... was used for first-strand cDNA synthesis using QuantiTect Reverse Transcription kit (QIAGEN, Germany) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: cDNA was synthesized from ≤ 1µg RNA using the QuantiTect Reverse Transcription Kit (Qiagen, 205311), snap-frozen and stored at −80 °C until further use ...
-
bioRxiv - Cell Biology 2022Quote: ... 1µg of RNA was converted to cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative real time PCR reactions were performed with cDNA using iTaq Universal SYBR Green supermix (Bio-Rad ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was generated using the QuantiTect reverse transcription kit with gDNA Wipeout (Qiagen, DE). Conventional PCR amplification of Gpr116 was achieved using the forward primer 5’ TCCAATTCGAGGGACCGAAG 3’ and reverse primer 5’ GTAGTTCACAACCACGCTGC 3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNAs were synthesized from ∼1 µg total RNA using QuantiTect Reverse Transcription kit (QIAGEN) according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2020Quote: ... and each sample was reverse transcribed using a QuantiTect Reverse transcription kit (Qiagen, #205313). qRT-PCR reactions were performed with LightCycler 480 SYBR Green I MasterMix (Roche ...
-
bioRxiv - Bioengineering 2020Quote: ... and RNA was reverse-transcribed to cDNA using a QuantiTect Reverse Transcription kit (Qiagen) and a S100 thermal cycler (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA (200 ng) was reverse-transcribed using the QuantiTect Reverse Transcription kit (Qiagen 205313). Quantitative PCR reactions were carried out in duplicates with SYBR Green I Master Mix (Roche S-7563 ...
-
bioRxiv - Genomics 2021Quote: ... and 500ng of mRNA were reverse transcribed using the QuantiTect reverse transcription kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Random-primer reverse transcription was done using RT2 First Strand kits (Qiagen; Valencia, CA), including a genomic DNA removal treatment ...
-
bioRxiv - Immunology 2020Quote: ... The RNA was reverse transcribed to cDNA with the Quantitect Reverse Transcription kit (Qiagen). Gene expression analysis was performed with primer assays from Qiagen [IL-10] and Eurofins [IL-12α ...
-
bioRxiv - Microbiology 2023Quote: RNA of cells was transcribed to cDNA using the QuantiTect Reverse Transcription Kit (Qiagen): 50-1000 ng RNA were mixed with RNAse-free water and gDNA Wipeout buffer for 2 min at 42°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... using oligo-dT priming and the QuantiTect Reverse Transcription Kit (QIAGEN, Cat No. 205310). Gene expression was measured by quantitative RT-PCR ...
-
bioRxiv - Bioengineering 2023Quote: ... before reverse transcribing to cDNA with the QuantiTect Reverse Transcription kit (Qiagen, Hilden, Germany). All cDNA samples were diluted with PCR-grade ultrapure water to 12.5 ng/µL prior to qPCR ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg mRNA per sample was used to perform reverse transcription (Qiagen, Cat. # 205311). Gene expression levels were then detected using SYBR Green (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... according to the manufacturer instructions and retrotranscribed with the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative real-time PCR reactions (TaqMan and SYBR Green ...
-
bioRxiv - Plant Biology 2023Quote: ... DNase treatment and cDNA synthesis was carried out using QuantiTect Reverse Transcription Kit (Qiagen). Expression of PIF4 and ARP6 was analyzed by semiqunatitative PCR and qPCR ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The reverse transcription reaction contains four units of Ominiscript™ reverse transcriptase (QIAGEN, Germany), 0.5 mM dNTP mixture ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was synthesized from 500 ng of RNA using QuantiTect Reverse Transcription Kit (Qiagen). Quantitative real-time PCR was performed using Select Master Mix (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... reverse transcription and qPCR were performed using the RT2 First Strand Kit (#330401, Qiagen) and RT² SYBR Green ROX qPCR MasterMix (#330522 ...
-
bioRxiv - Genetics 2024Quote: ... 200ng RNA was reverse transcribed using QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). qRT-PCR was performed in technical duplicate or triplicate using SYBR FAST qPCR Master Mix (Kapa Biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... Complementary DNA (cDNA) synthesis was performed using the QuantiTect Reverse Transcription Kit (205313, Qiagen). qRT-PCR was performed on a QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... Equal quantities of RNA were transcribed into cDNA using QuantiTect Reverse Transcription kits (Qiagen), and analysis of targets gene expression was performed on a 7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... this was reverse transcribed to cDNA using the Quantitect Reverse Transcription Kit (Qiagen, Germany). To obtain a more complete library ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA was prepared from 1 µg of RNA using QuantiNova Reverse Transcription Kit (Qiagen). SYBR Green I Master (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... the extracted RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit from Qiagen as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... RNA extraction and reverse transcription were performed using the RNeasy plus mini kit (QIAGEN) and Superscript II (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... 12 µL were reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen), as described elsewhere (14) ...
-
bioRxiv - Cell Biology 2022Quote: Reverse transcription was carried out using the miRCURY LNA™1 RT Kit (Qiagen) using 10 ng of RNA according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Reverse transcription for cDNA synthesis was performed using M-MuLV Reverse Transcriptase (Enzymatics, Qiagen) and RNAse Inhibitor (Biotechrabbit) ...
-
bioRxiv - Neuroscience 2022Quote: Complementary DNA (cDNA) synthesis was performed using the QuantiTect Reverse Transcription Kit (Qiagen, #205313). Quantitative PCR (qPCR ...
-
bioRxiv - Genomics 2023Quote: ... 200ng total RNAs were reverse transcript into cDNA using QuantiTect Reverse Transcription Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA samples were converted to cDNA using the QuantiTect Reverse Transcription Kit (205313, Qiagen) into cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA library was prepared by using the QuantiTect reverse transcription kit (Qiagen, Valencia, CA). The cDNA library was then sent to the Genomic Services Laboratory at HudsonAlpha Genome Sequencing Center (Huntsville ...
-
Insulin Resistance Increases TNBC Aggressiveness and Brain Metastasis via Adipocyte-derived ExosomesbioRxiv - Cancer Biology 2024Quote: ... RNA was then used to prepare cDNA using QuantiTect Reverse Transcription Kit (Qiagen, 205313). Mouse RT2 Profiler™ PCR Array ...
-
bioRxiv - Microbiology 2024Quote: ... a reaction for reverse transcription was performed using the RT2 First Strand Kit (QIAGEN).
-
bioRxiv - Immunology 2024Quote: ... following the manufacturer’s instructions for the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany, #205311). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA (1 μg) was reverse transcribed using the Quantitect Reverse Transcription Kit (Qiagen). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription of 1 μg RNA was performed using Omniscript RT kit (Qiagen, #205111). CLN3 transcript was amplified ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was synthesised using 1µg RNA as template using Quantitect Reverse Transcription Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Retrotranscription into complementary DNA (cDNA) was performed using the Quantitect Reverse Transcription Kit (Qiagen). The expression levels of the following murine genes were determined by quantitative PCR (qPCR ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was reverse transcribed into cDNA using the QuantiTect reverse transcription kit (Qiagen, #205311) as per manufacturer’s instructions ...