Labshake search
Citations for Qiagen :
1 - 50 of 1519 citations for ETS Related Transcription Factor Elf 3 ELF3 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Transcription factor prediction was performed with Ingenuity Pathway Analysis (Qiagen), iRegulon (Janky et al ...
-
bioRxiv - Cancer Biology 2022Quote: A ready-to-transduce transcription factor-responsive lentiviral reporter system (CCS-1022L, QIAGEN) was used to generate a stable cell line ...
-
bioRxiv - Cancer Biology 2022Quote: ... The transcription factor prediction was performed using i-cisTarget20 and the upstream regulator function by QIAGEN Ingenuity Pathway Analysis.21 Differentially expressed genes (DEGs ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies (α-His HRP conjugated (Qiagen 34460) or α -VSV-G (Millipore sigma V4888-200UG) ...
-
bioRxiv - Biochemistry 2022Quote: ... and HRP–conjugated anti Penta-His antibody (Qiagen). Other chemicals used in this study were of an analytical grade or higher ...
-
bioRxiv - Cell Biology 2022Quote: The heatmaps relative to the ERK-dependent AP-1 target genes were generated by interrogating the Transcription Factor Target (TFT) collection (MSigDB) and TF binding site database by QIAGEN with the top DEGs between control and PD-treated Acomys ...
-
LSD1 inhibition improves efficacy of adoptive T cell therapy by enhancing CD8+ T cell responsivenessbioRxiv - Immunology 2023Quote: ... Pathway analysis and transcription factor prediction analysis were performed with QIAGEN’s Ingenuity Pathway Analysis (IPA, QIAGEN Redwood City, www.qiagen.com/ingenuity).
-
bioRxiv - Cancer Biology 2024Quote: ... The target genes were selected based on their association with these transcription factors as identified through chromatin immunoprecipitation (ChIP) assays and from QIAGEN IPA databases ...
-
bioRxiv - Cell Biology 2021Quote: ... migration and cell death-related signalling pathways were conducted using the Ingenuity Pathway Analysis software (QIAGEN), as previously described (Johnson et al. ...
-
bioRxiv - Microbiology 2021Quote: ... and NL_ZS_3 and the genomes of related phages were analyzed using CLC Main Workbench (CLC, Qiagen). To construct the phylogenetic tree of phage terminase large subunits ...
-
bioRxiv - Biophysics 2020Quote: ... anti-His antibodies from the Penta-His HRP Conjugate Kit (Qiagen) were used.
-
bioRxiv - Biochemistry 2022Quote: ... anti-His antibodies from the Penta-His HRP Conjugate Kit (Qiagen) were used ...
-
bioRxiv - Microbiology 2020Quote: ... An anti·His antibody conjugated to horseradish peroxidase (Penta·His HRP Conjugate, Qiagen) was used to detect 6xHis-tagged proteins ...
-
bioRxiv - Immunology 2021Quote: EnrichR (Chen et al., 2013; Kuleshov et al., 2016) and Ingenuity Pathway Analysis (Qiagen) were used to calculate pathway enrichment ...
-
bioRxiv - Bioengineering 2021Quote: ... supernatant was collected and Factor Xa was removed with Factor Xa Removal Resin (QIAGEN). Endotoxin was removed using endotoxin removal resin and Atsttrin purity was determined by SDS-PAGE and reverse phase high performance liquid chromatography (HPLC).
-
bioRxiv - Biochemistry 2024Quote: ... A Western blot on nitrocellulose using a PentaHis Antibody HRP conjugate (Qiagen) produced a positive result for the band identified as NONO ...
-
bioRxiv - Genomics 2020Quote: ... Sachinoka plantlets grown in vermiculite under 12 h light/12 h dark conditions at 22°C were isolated using the improved 3% CTAB3 method (Yu et al. 2012) followed by treatment with RNase-free DNase (QIAGEN, Venlo, Netherlands) and clean up with RNeasy spin columns (QIAGEN ...
-
bioRxiv - Neuroscience 2023Quote: ... and hsa-miR-519a-3p miRCURY LNA miRNA Mimic or its related Negative Control miRCURY LNA miRNA Mimic (Qiagen). Cell lysates were prepared 24 hours later in passive lysis buffer following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription was performed using QuantiTect Reverse Transcription kit (Qiagen). Human cell motility RT2 profiler PCR Array (Qiagen ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... followed by reverse transcription using QuantiTect Reverse Transcription Kit (Qiagen) and PCR using primers that flank the targeted exons ...
-
bioRxiv - Developmental Biology 2022Quote: ... Reverse transcription was done using QuantiTect Reverse Transcription Kit (Qiagen). qRT-PCR was performed using AmpliTaq Gold® DNA Polymerase (Thermo Fisher ...
-
bioRxiv - Bioengineering 2022Quote: ... Transcription Kit (QIAGEN). qPCR was performed on the StepOne™ system (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... Transcription Kit (Qiagen), followed by qPCR with QuantiNova SYBR Green PCR Kit (Qiagen) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Transcription Kit (QIAGEN). Manual specifications were followed ...
-
bioRxiv - Microbiology 2023Quote: ... Transcription Kit (Qiagen). Detailed information about designing a specific arsM gene primer set ...
-
bioRxiv - Cell Biology 2022Quote: ... Transcription Kit (QIAGEN), quantitative PCR was performed on the StepOne™ system (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... Differentially expressed STAT3-related genes (upstream and downstream) between ALDH+ and ALDH-cells were identified using Ingenuity Pathway Analysis (Qiagen).
-
bioRxiv - Immunology 2024Quote: Reverse transcription and PCR I were performed in 384-well plates pre-loaded with 3 µL of Vapor-Lock (Qiagen). Cell lysis buffer and reverse transcriptase mix (0.4 µL/well ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription was conducted using QuantiTect® Reverse Transcription Kit (Qiagen,). Real-time PCR was performed using the Custom RT² Profiler PCR Array according to the manufacturer’s instructions (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reverse transcription was performed using the Quantitect Reverse Transcription Kit (Qiagen). cDNA was detected using Power Up SYBR Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... and reverse transcription using a QuantiTet Reverse Transcription kit (205311; QIAGEN). Relative quantification of genomic DNA or cDNA was performed on a 7900HT Fast Real-Time PCR System (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... Reverse transcription was performed with the Quantitect reverse transcription kit (Qiagen). qRT-PCR was conducted in triplicate using Quantitect SYBR Green PCR reagent (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... Reverse transcription was performed using the QuantiTect Reverse Transcription Kit (Qiagen). 1 μg total RNA was used in each reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... Retro-transcription was conducted using a Quantitect Reverse Transcription kit (Qiagen) with a first step of genomic DNA elimination ...
-
bioRxiv - Microbiology 2022Quote: ... Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using virus-specific reverse primers for SINV (GTTGAAGAATCCGCATTGCATGG) ...
-
bioRxiv - Cell Biology 2022Quote: ... After reverse transcription with the Quantitect reverse transcription kit (Qiagen, 205311), SYBR green qPCR was performed (Takyon ...
-
bioRxiv - Developmental Biology 2024Quote: ... Reverse transcription was then performed using QuantiTect reverse transcription kit (Qiagen). The qPCR assays for detecting KLF4 (Mr04421256_mr) ...
-
bioRxiv - Pathology 2024Quote: Reverse transcription was completed with the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Biochemistry 2022Quote: ... an anti GAPDH monoclonal antibody (SC-47724) or an anti RGS HIS6 HRP (QIAGEN). When necessary ...
-
bioRxiv - Microbiology 2021Quote: ... tularensis IM protein SecY (Huntley, 2007) or the Penta-His HRP conjugate antibody (Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: ... Gene Ontology analysis of mass spec results was done using DAVID v6.8 functional annotation analysis (Huang et al., 2009a; Huang et al., 2009b) or IPA (QIAGEN Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... Reverse transcription was performed via the miScript II reverse transcription kit (Qiagen). qPCR was performed using the RotorGeneQ thermocycling system (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: Reverse transcription was performed using the QuantiTect® Reverse Transcription Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2021Quote: ... Reverse transcription reaction was performed with the miScript Reverse Transcription kit (QIAGEN), and cDNA was amplified by real-time PCR with a miScript SYBR Green kit (QIAGEN) ...
-
bioRxiv - Cell Biology 2024Quote: ... Retro-transcription into cDNA was performed using QuantiTect Reverse Transcription kit (Qiagen).
-
bioRxiv - Bioengineering 2023Quote: ... before reverse transcription into cDNA using QuantiTect Reverse Transcription Kit (Qiagen, Germany). qPCR was performed with PowerTrackTM SYBR Green Master Mix kit (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse transcription was carried out with QuantiTect Reverse Transcription Kit (Qiagen) with indicated primers (Table 3 ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription was performed using QuantiTect Reverse Transcription Kit (Qiagen, cat. 205311) following the manufacturer’s instructions with 1 or 2μg RNA input ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription was carried out with the Quantitect Reverse Transcription kit (Qiagen) as per the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2024Quote: ... Transcription Kit (205314, Qiagen) according to the manufacturer’s instructions ...