Labshake search
Citations for Qiagen :
2151 - 2200 of 3116 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and approximately 1 µg of isolated RNA was converted to cDNA using RT2 First Strand Kit (Qiagen, Hilden, Germany). cDNA was diluted (1:10 ...
-
bioRxiv - Systems Biology 2023Quote: ... Large fragments (200-400 bp) were extracted from a 1% agarose gel with QIAquick Gel Extraction Kit (Qiagen, Netherlands). The final library was sequenced as 85 bp long single-end reads on a NextSeq™ 550 (Illumina ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was diluted 3 times with buffer A (20 mM HEPES, pH 7.4, 200 mM NaCl, 1 mM Asp) and incubated with Ni-NTA resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Cancer Biology 2023Quote: ... culture medium was replaced with base medium 1 hour before transfection and cells were transfected with miRNA mimics (Qiagen), including hsa-let-7a-5p (UGAGGUAGUAGGUUGUAUAGUU) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The OsHV-1 µVar DNA was extracted from 200 µL of water using the QIAmp DNA mini Kit (QIAGEN). Quantitative PCR was performed with 5 µL of DNA as described 46.
-
bioRxiv - Developmental Biology 2023Quote: Blastocysts were washed with DPBS containing 1 mg/ml polyvinylpyrrolidone (PBS-PVP) and transferred into 50 μl droplets of 0.1% protease (Qiagen) to remove the zona pellucida ...
-
bioRxiv - Bioengineering 2023Quote: ... total RNA was extracted from about 1 × 106 cells from all groups using RNeasy Mini Kit (Qiagen, Valencia, CA), then using the random hexamer primer and M-MuLV reverse transcriptase kit (Fermentas ...
-
bioRxiv - Microbiology 2023Quote: ... The tissue pellets were resuspended in 1 ml of FSW using a tissue lyser (Tissue-Lyser II, Qiagen, Australia) and the resuspension was homogenized using sterile glass homogenizers for 30 s ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Immunology 2023Quote: The post-caval lobe of the lung was weighed and homogenized in 1 mL of PBS (pH 7.4) using a TissueLyser LT (Qiagen). RNA was extracted using TRIzol™ LS Reagent (Invitrogen ...
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Genomics 2023Quote: ... After overnight proteinase K digestion in Lysis Buffer (BNG) and 1-hour treatment with RNAse A (Qiagen, MD,USA), plugs were washed 4 times in 1×Wash Buffer (BNG ...
-
bioRxiv - Genomics 2023Quote: ... 1×106 cells were harvested from each culture and DNA was extracted using QIAamp DNA mini Kit (QIAGEN 51304). STR analysis was performed with PowerPlex 21 System (Promega DC8902 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 9-10 mL of Buffer BB (1/3 of the lysate volume, From QIAGEN Plasmid Plus Midi Kit) was added ...
-
bioRxiv - Microbiology 2024Quote: ... DNA on the exterior of filtered capsids was digested for 1 h at 25°C with 20.3 units DNase (79254; Qiagen) supplemented with 10 mM MgCl2 ...
-
bioRxiv - Plant Biology 2024Quote: ... four leaf discs (1 cm in diameter) were snap frozen in liquid nitrogen and powdered using a TissueLyser (QIAGEN). Total proteins were extracted from the powder using 400 μL GTEN buffer (10% glycerol ...
-
bioRxiv - Physiology 2024Quote: ... RNA (1 μg, quantified via Nanodrop-2000 spectrophotometer) was transcribed to cDNA using the QuantiTect Reverse Transcription kit (QIAGEN) and stored at -20°C prior to analysis ...
-
bioRxiv - Plant Biology 2024Quote: ... and ground for 1 min at 30 Hz with the pre-cooled Retsch Mill (Tissue Lyser II, Retsch, Qiagen). For quantification of S ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized from 1 µg of total RNA using the RT2 First Strand Kit (Qiagen, Germantown, MD, USA), following the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 × 106 MES or CP cells were harvested and RNA extraction was performed using Rneasy mini plus kit (Qiagen). 1 μg of total RNA was used for the construction of sequencing libraries and sequencing.
-
bioRxiv - Microbiology 2024Quote: ... Samples were then incubated with Dynabeads for 2hr at 4°C and washed as previously described [89] prior to being eluted in elution buffer (1% SDS, 1mM EDTA, 0.01M pH 8 Tris-HCl, and 0.2M NaCl) supplemented with proteinase K (Qiagen, 1114885) and Rnase A (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: The typhoid toxin was purified from BL21 DE3 pETDuet-1 encoding pltBHis pltAMyc and cdtBFLAG using NiNTA agarose (Qiagen) affinity chromatography according to manufacturer instructions as previously described (Ibler et al 2019) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Complementary DNA (cDNA) was synthesized from 1 ug of RNA using the QuantiTect reverse transcription kit (Qiagen, catalog #205311) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and were then incubated with or without triton-x (1% v/v) and with or without Rnase-A (Qiagen #19101 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of total RNA was used to synthesize cDNA using a QuantiNova Reverse Transcription kit (205410, Qiagen, UK). qPCR was performed using QuantiNova SYBR green (208052 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 mL of TRIzol reagent was added to each sample and homogenized using a TissueLyser LT (Qiagen, Hilden, Germany) for 2 minutes at 50 Hz ...
-
bioRxiv - Microbiology 2024Quote: ... for 10 min and the cell lysates were incubated with 1 mL of prewashed Ni-NTA Agarose beads (QIAGEN) shaking at 4°C for 1.5 h ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 mL of TRIzol reagent was added to each sample and homogenized using a TissueLyser LT (Qiagen, Hilden, Germany) for 2 minutes at 50 Hz ...
-
bioRxiv - Synthetic Biology 2024Quote: ... samples were subjected to bead-beating by adding 100 mg of 0.1 mm zirconia beads and 1 ml of inhibiTEX buffer (Qiagen) to each tube ...
-
bioRxiv - Genomics 2024Quote: Total RNA was isolated from 1 million microglial cells per cell line using the RNeasy Mini kit (QIAGEN, #74104) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... using random hexamers and diluted 1:10 prior to quantification by qPCR (QuantiFast SYBR Green PCR kit, Qiagen, #28025013) using a Corbett Rotor-Gene 6000 (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were incubated with 20 μg/ml propidium iodide (containing 0,5% Tween-20, 1% BSA and 10 μg/ml RNase A (Qiagen) for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 µg of viral RNA were utilized to transfect HeLa cells cultured at 37°C using TransMessenger reagent (Qiagen) following the manufacturers protocol ...
-
bioRxiv - Genetics 2024Quote: ... Red blood cells were lysed with 0.1% saponin in 1×PBS and parasite DNA extracted with the QIAamp DNA Blood Midi Kit (Qiagen) using a combined RNase and Proteinase K treatment ...
-
bioRxiv - Cell Biology 2022Quote: ... single cells were sorted into PCR plates containing 5 µl Buffer RLT Plus (Qiagen) with 1% BME and immediately frozen at -80°C for G&T sequencing.
-
bioRxiv - Developmental Biology 2020Quote: During collection single embryos were placed for lysis in 5 ul TCL buffer (Qiagen) containing 1% (v/v ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was loaded onto a 5 ml Ni-NTA agarose bead slurry (Qiagen) equilibrated with equilibration buffer [20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Plant Biology 2021Quote: ... dry material was homogenized using 5 mm steel beads and a Tissuelyser II (Qiagen) for 1 min at 30 Hz ...
-
bioRxiv - Microbiology 2020Quote: ... Clarified lysates were passed over 5 ml of packed Ni-NTA agarose resin (Qiagen) at 1.0 ml/min ...
-
bioRxiv - Physiology 2020Quote: ... and 5 μl of QuantiFast SYBR Green RT-PCR Master Mix (Qiagen, Manchester, UK). Reverse transcription was initiated with a hold at 50°C for 10 minutes (cDNA synthesis ...
-
bioRxiv - Cell Biology 2020Quote: ... dNTPs and synthetic mRNA Spike-Ins contained in 5 μl of Vapor-Lock (Qiagen). Immediately following sorting ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Plasmids of 5 µg were transfected into 6x10[6] S2 cells using Effectene (Qiagen) and incubated for 3 days ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were reverse transfected with 5 pmol of each siRNA (QIAGEN) using lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Physiology 2020Quote: ... and 5 μl of QuantiFast SYBR Green RT-PCR Master Mix (Qiagen, Manchester, UK). Reverse transcription was initiated with a hold at 50°C for 10 minutes (cDNA synthesis ...
-
bioRxiv - Biochemistry 2021Quote: ... and the supernatant was applied to two 5 ml Ni-NTA Superflow cartridges (Qiagen). The columns were washed with 20 mM HEPES pH 8.0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... then subsequently homogenised four times with a 5 mm diameter stainless steel bead (Qiagen) for 3 min at 50 Hz using a TissueLyser LT (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... were isolated using the “miRNeasy Mini Kit” (cell numbers ≥ 5 × 105, Qiagen, Cat# 217004). FACS-isolated FO or MZ B cells were directly sorted into the Qiazol Lysis Reagent (700 μl final volume) ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from pools of 5 females using an RNeasy Mini kit (Qiagen) by first homogenizing them using a plastic pestle in 600 µL of lysis buffer in a 1.5 mL microfuge tube ...