Labshake search
Citations for Qiagen :
1551 - 1600 of 6611 citations for SARS CoV 2 Spike Glycoprotein S1 His tag Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... The supernatant containing solubilized protein was filtered using a 0.22 μM nylon membrane filter and incubated with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germantown, MD) at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Genomics 2019Quote: ... 200 μl lysis buffer were used per organoid for homogenization at 12,000 x g for 2 min in a QIAshredder Column (Qiagen, Hilden, Germany) after lysis and prior to addition of 70% ethanol ...
-
bioRxiv - Molecular Biology 2020Quote: ... mantle (Ma) and gonad (Go) tissues were collected and individually transferred to 2-mL tubes containing RNA later (QIAGEN, Maryland, USA) separately ...
-
bioRxiv - Plant Biology 2019Quote: ... 50,000 protoplasts in a volume of 100 μL were transformed with 20 μg of each plasmid (2 μg/μL) purified using the Plasmid Maxi kit (Qiagen, Germany). One batch of protoplasts was treated with an equivalent amount of water and used as the negative (untransformed ...
-
bioRxiv - Microbiology 2019Quote: We carried out RNA extraction on a litter aliquot of 0.2 g for shrub and 0.5 g for grass using RNeasy PowerSoil Total RNA Kit following manufacturer instructions (Qiagen, Hilden, Germany). Due to a high amount of organic compounds co-extracted from shrub litter ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We extracted RNA from a total of 348 individuals across two early developmental stages (2 days post fertilization (dpf) and 8 dpf) using RNeasy Mini Kits (Qiagen, Inc.). For 2 dpf libraries ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18 S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Biochemistry 2020Quote: ... 4°C) an applied to a 2 ml Ni-NTA immobilised metal affinity chromatography (IMAC) gravity flow column (QIAGEN, Hilden, Germany). Columns were washed in 10 column volumes (CV ...
-
bioRxiv - Microbiology 2020Quote: ... Each 10 μL uPCR reaction contained 2 μL of DNA template with 1x QuantiTect Multiplex PCR No ROX mastermix (Qiagen™), 0.4 μM each primer ...
-
bioRxiv - Plant Biology 2020Quote: ... by shaking with two 3-mm glass beads for 2 min at 30 Hz with a Tissue-Lyser (Qiagen, Hilden, Germany). After 5 min in an ice-cold ultrasonic bath ...
-
bioRxiv - Genomics 2021Quote: ... The samples were then transferred to RNeasy spin columns and 2 ml collection tubes from an RNeasy Mini Kit (Qiagen, 74104) and centrifuged at 13,000 rpm for 15 sec ...
-
bioRxiv - Genomics 2022Quote: Buccal swab samples were placed in 2 mL Eppendorf tubes and were extracted using a modified version of the DNeasy® Blood and Tissue Kit (Qiagen). In each tube were added 380 μL of ATL Buffer and 20 μL of Proteinase K (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... The clinical Samples (cervical smear) for the HPV DNA test were processed using HPV Test Hybrid Capture® 2 protocol (QIAGEN). Samples with relative light units (RLU ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from a minimum of 2 × 106 sorted MDSCs or nonMDSCs using an RNAeasy Mini Kit (Qiagen, Germantown, MD). RNA sequencing was performed by GENEWIZ (South Palinfield ...
-
bioRxiv - Genomics 2022Quote: The second lobe of lung or trachea was immersed in 1 mL PBS in a 2 mL Micro Centrifuge Tube (Fisherbrand, 14-666-315) containing one stainless steel bead (5 mm, QIAGEN, 1026563) immediately after dissecting the SARS-CoV-2 infected mouse or hamster ...
-
bioRxiv - Genomics 2022Quote: ... Trachea was dissected and immersed in 1 mL PBS in a 2 mL microcentrifuge tube (Fisherbrand, 14-666-315) containing one stainless steel bead (QIAGEN, 69989). After the homogenization ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Cell Biology 2019Quote: ... Transient transfections were carried out using just subconfluent cultures in 35 mm plates or in wells of a 6-well plate using DNA in the range of 0.3-2 µg/culture and the Polyfect reagent (Qiagen, Germantown, MD) and the manufacturer’s protocol ...
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Epidemiology 2020Quote: ... Then a steel ball was added and samples were crushed twice during 2 min at 30 Hz/s with the Tissue Lyzer (Qiagen, Germany). 450 µL of fresh PBS 1X were added to the samples ...
-
bioRxiv - Genetics 2019Quote: ... The whole body of a single insect was homogenized in a PCR well containing 50 μl of the Lysis & Binding Solution and zirconia beads (ø 2 mm; Nikkato) in TissueLyser II (QIAGEN) at 25 Hz for 30 s ...
-
rpoB, a promising marker for analyzing the diversity of bacterial communities by amplicon sequencingbioRxiv - Microbiology 2019Quote: ... IJs were crushed by three cycles of mechanical grinding (2 minutes at 30 Hz followed by 1 minute without agitation) in a TissueLyser II apparatus (Qiagen, France). We added 2 µL of Ready-Lyse Lysozyme Solution (Epi-centre ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and ∼55 mg of total protein in CFE was incubated for 60 min at 4 °C with 2 mL of Ni-NTA agarose (QIAGEN, Germany) equilibrated with purification buffer A ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was isolated from 2 g of homogenized material from frozen needles using the DNeasy Plant Maxi Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Amplicons were separated on a 1-2% agarose gel and appropriate bands were excised and isolated using a gel extraction kit (Qiagen, USA). These fragments were inserted into the pcDNA3.1-based plasmid or cFUGW lentivirus vector using the T4 ligase (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: Isolated Chromatin was digested with 1% proteinase K for 2 hrs at 60 °C with 300 rpm and was subsequently purified by using QIAquick® Nucleotide Removal Kit (28306, Qiagen) according to the manufactory’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Transient transfections were carried out using just subconfluent cultures in 35 mm plates using DNA in the range of 0.3-2 µg/culture and the Polyfect reagent (Qiagen, Germantown, MD) and the manufacturer’s protocol (with 10 µl Polyfect reagent per 35 mm plate).
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR was monitored on Rotor-Gene® Q-Pure Detection System (Software Ver. 2, Qiagen Inc., Valencia, CA, USA) and performed using QuantiFast SYBR® Green PCR Master Mix (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... or remaining mosquito bodies were collected separately in a 2ml Eppendorf Safe Lock tube with 250μl DMEM (2% FBS, 1% Sodium Pyruvate) with 25 mg/ml Amphotericin B and a stainless steel bead (Qiagen, Hilden, Germany). Samples were stored at −80°C.
-
bioRxiv - Microbiology 2020Quote: ... and then with (2) 15 µl Proteinase K [>600 mA/ml] and 5 µl Rnase A [100 mg/ml] (Qiagen, Germany) for 5min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged at 5000 g for 2 hours at 4 °C and the pellet was collected for DNA extraction with a DNeasy PowerSoil kit (Qiagen, Germany). The sediment from Lime Blue was collected with a freeze core (modified from Stocker and Williams ...
-
bioRxiv - Biochemistry 2022Quote: ... Transient transfections were carried out using just subconfluent cultures in 35 mm plates using DNA in the range of 0.3-2 µg/culture and the Polyfect reagent (Qiagen, Germantown, MD) and the manufacturer’s protocol (with 10 µl Polyfect reagent per 35 mm plate).
-
bioRxiv - Plant Biology 2022Quote: ... The frozen plant material was ground to a fine powder using 2 mm Ø glass beads (Huberlab) and a TissueLyser (Qiagen) for 1 min at maximum frequency ...
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Neuroscience 2022Quote: Dissected cortex and striatum were homogenized 2 x 1min at 25 Hz in 750μL of QIAzol Lysis Reagent (Qiagen, Valencia, CA) with TissueLyser (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... Complementary DNA (cDNA) was subsequently generated using 2 μg of total RNA and the miScript II Reverse Transcription (RT) Kit (Qiagen, Australia), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exosomal miRNAs were profiled using Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, #YAHS-106Y, Plate Format: 2 × 96-well).
-
bioRxiv - Immunology 2022Quote: ... 350 µL of aqueous phase was transferred into a 2 mL reaction tube and subjected to the QIAcube (QIAGEN, Hilden, Germany) for RNA isolation ...
-
bioRxiv - Bioengineering 2024Quote: ... posterior eye cups (PECs) were separated and collected in 2 mL reinforced tubes (SPEX Sample Prep) containing 5 mM stainless steel beads (Qiagen, LLC).
-
bioRxiv - Molecular Biology 2023Quote: ... One mL TRIzol was added to all samples and homogenized with stainless steel grinding balls for 2 minutes at 30 Hz using a TissueLyser II bead mill (Qiagen, USA). Then ...
-
bioRxiv - Molecular Biology 2023Quote: ... The homogenization was performed using a Tissue-Lyser II with stainless steel grinding balls (2 x 30s at 30 Hz) (Qiagen, USA). After 30 minutes of end-over-end at 5°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... was added to each sample tube and homogenization was conducted with two shaking steps at 25 Hz for 2 min by TissueLyser (Qiagen, USA). RNA extraction was performed with the Direct-zol RNA MicroPrep Plus kit (Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 μg of RNA was used to generate cDNA using the RT2 First Strand Kit (#330401, SABiosciences, a Qiagen Company). In a fluorescent temperature cycler ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Halo protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9 wash buffer I (50 mM NaxPO4 pH 7.0 and 300 mM NaCl ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Cys protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9-Cys wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Neuroscience 2023Quote: ... After protein digestion (PK Buffer and Proteinase K (20 mg/mL) for 2 hrs at 45°C) DNA was purified with QIAquick PCR Purification Kit (Qiagen, Germany) according to manufacturer instruction ...