Labshake search
Citations for Qiagen :
1451 - 1500 of 6287 citations for SARS CoV 2 Spike Glycoprotein S1 His tag Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and primary cells using Rneasy Kit (Qiagen) according to the manufacturer’s instructions ...
-
Efficient Methods for Target Gene Manipulation in Haematopoietic Stem Cell Derived Human NeutrophilsbioRxiv - Cell Biology 2023Quote: Cells were lysed in RLT buffer (Qiagen) supplemented with 1% ß-mercaptoethanol (β-ME ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were transfected using Polyfect (QIAGEN), while U2OS cells were transfected using TransIT-LT1 Transfection Reagent (Mirus Bio) ...
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed with TCL buffer (Qiagen) with 1% of ß-mercaptoethanol and stored at -80°C.
-
bioRxiv - Cancer Biology 2023Quote: ... cells were harvested in Buffer RLT (Qiagen), and gene expression was measured by quantitative PCR ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell pellets were resuspended in Qiazol (Qiagen) and stored at − 80 °C before total RNA extraction with the miRNAeasy (Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: Mouse EL4 genomic DNA was isolated by QIAGEN Blood & Cell Culture DNA Kit (QIAGEN, #13343). The purified genomic DNA was then fragmented to 100∼200 bp using DNase I (ZYMO RESEARCH ...
-
bioRxiv - Immunology 2023Quote: Cells were lysed in RLT buffer (QIAGEN) supplemented with 38 mM DTT ...
-
bioRxiv - Microbiology 2023Quote: Infected cells were lysed in RLT (Qiagen) supplemented with 0.1% beta-mercaptoethanol (Sigma) ...
-
bioRxiv - Synthetic Biology 2023Quote: Cells were lysed using Buffer RLT (Qiagen) and homogenized using either syringes and needles or QIAshredder (Qiagen) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were transfected using Effectene (Qiagen #301427), incubated for 44–48 hours at 28°C ...
-
bioRxiv - Synthetic Biology 2021Quote: Total RNA was isolated from infected Hela cells (experiment) and HeLa cells co-cultured with non-engineered E.coli (control) using RNeasy Mini Kit (Qiagen) and then reverse transcribed using QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic DNA from 3×107 sorted GFP+ cells was extracted using the Blood & Cell Culture DNA Maxi Kit (Qiagen). Amplification of sgRNA regions from the extracted genome and the original sgRNA plasmid library ...
-
bioRxiv - Microbiology 2021Quote: ... 10,000 positive cells and 10,000 negative cells were sorted from three independent biological replicates directly into RLT Lysis buffer (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... cells were harvested and genomic DNA (gDNA) was isolated from surviving cells using a QIAmp DNA Mini Kit (QIAGEN) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... Genomic DNA (gDNA) was extracted from each transduced cell culture using a blood & cell culture DNA mini kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA from 1-5 million total CD4+ T cells was isolated using the Gentra Puregene Cell Kit (Qiagen) or phenol-chloroform and the DNA concentration was measured by Qubit High Sensitivity Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was isolated from cells in 96-well plates using the Qiagen FastLane Cell Probe Kit (QIAGEN, 216413), according to the manufacturer’s instructions to a final volume of 40 μL per well ...
-
bioRxiv - Microbiology 2019Quote: miRNA isolation from hNS1 cells and foetal neural stem cells were performed using miRNeasy mini kit (Qiagen, CA, USA) following manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2021Quote: Approximately 2 × 106 undifferentiated MØP cells or M-CSF differentiated MØP cells were lysed in accordance with the Qiagen RNeasy Mini kit (Qiagen). The concentration of RNA was measured using either a Nanodrop™ 2000 (Thermofisher Scientific ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA (gDNA) was isolated using the Blood & Cell Culture DNA Midi (5e6–3e07 cells) (Qiagen, cat. no. 13343), or Mini (<5e6 cells ...
-
bioRxiv - Genetics 2021Quote: ... We extracted DNA from approximately 1-2 million cells of actively growing culture by first pelleting the cells and resuspending them in 1.0 mL Cell Lysis Solution (Qiagen). The samples were incubated with RNase A solution at 37°C for 40 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... SCID GFP positive FACS-sorted cells and the mT3-2D-GFP cell line using the RNeasy Micro Kit (Qiagen). RNA concentration and quality were assessed using an Agilent BioAnalyzer ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa cells suspended at 0.8 × 105 cells/ml were transfected with 50 nM siRNA using HiPerfect transfection reagent (Qiagen) according to the manufacturer’s protocol and analysed after 48 h ...
-
bioRxiv - Neuroscience 2023Quote: ... FACS-sorted cells (≈ 98% tdTomato+ cells) were harvested in RLT and RNA extracted with RNeasy Micro kit (Cat. # Qiagen). Around 100 000 tdTomato+ cells were sorted from 10 electroporated-brains for each sample to sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were then seeded in 6-well dishes (6x105 cells/well) and reverse transfected using Polyfect (Qiagen, 301105) following the manufacturers protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Human DNA from whole cell extracts of A549 cells was purified using the DNeasy Blood and Tissue kit (Qiagen). RNAseA (Thermo ...
-
bioRxiv - Cancer Biology 2023Quote: ... red blood cells were lysed in five times the amount of red blood cell lysis solution (Qiagen, Hilden, Germany), followed by 15 min of incubation at room temperature (24°C) ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA was extracted from isolated cells (microglia or non-microglia cells) with RNeasy RNA Isolation kit (Qiagen 74104) and used to generate cDNA with a High-Capacity cDNA Reverse Transcription Kit (Thermo 4368814) ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA (gDNA) was extracted from J-Lat cells 10.6 and HIV-1 negative CD4+ T cells with the QIAcube (Qiagen), using the QiaAmp DNA mini kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... genomic DNA from sorted cell pellets was extracted using the QIAGEN Blood & Cell Culture DNA Maxi Kit (QIAGEN; 13362) and quantified by Qubit (Thermo-Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Single cell suspensions from SPL and BM were subjected to red blood cell lysis (erythrocyte lysis buffer, EL; Qiagen). Monoclonal antibodies (mAbs ...
-
bioRxiv - Genetics 2023Quote: ... genomic DNA from sorted cell pellets was extracted using the QIAGEN Blood & Cell Culture DNA Maxi Kit (QIAGEN; 13362) and quantified by Qubit (ThermoScientific ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA from each cell was amplified using the Repli-G Advanced DNA Single-Cell kit and protocol (QIAGEN) for amplifying purified genomic DNA ...
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was extracted from 5-10×106 cells using the Gentra Puregene Cell Kit (Qiagen, cat no. 158046) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA was extracted from sorted cells (1,3×107 cells per channel) using the QIAamp DNA Mini kit (Qiagen). Gene-trap insertion site recovery and sequencing libraries were generated as previously described 60.
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA was isolated from cell pellets using a genomic DNA isolation kit (Blood & Cell Culture Midi kit (Qiagen)) ...
-
bioRxiv - Plant Biology 2020Quote: ... a 2 ml subsample of the coarse powder was ground to a fine powder using a Qiagen TissueLyser (Qiagen, Germantown, MD). Finely powdered leaf tissue was then sent to Midwest Laboratories (Omaha ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant containing solubilized protein was filtered using a 0.22 μM nylon membrane filter and incubated with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germantown, MD) at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Genomics 2019Quote: ... 200 μl lysis buffer were used per organoid for homogenization at 12,000 x g for 2 min in a QIAshredder Column (Qiagen, Hilden, Germany) after lysis and prior to addition of 70% ethanol ...
-
bioRxiv - Molecular Biology 2020Quote: ... mantle (Ma) and gonad (Go) tissues were collected and individually transferred to 2-mL tubes containing RNA later (QIAGEN, Maryland, USA) separately ...
-
bioRxiv - Plant Biology 2019Quote: ... 50,000 protoplasts in a volume of 100 μL were transformed with 20 μg of each plasmid (2 μg/μL) purified using the Plasmid Maxi kit (Qiagen, Germany). One batch of protoplasts was treated with an equivalent amount of water and used as the negative (untransformed ...
-
bioRxiv - Microbiology 2019Quote: We carried out RNA extraction on a litter aliquot of 0.2 g for shrub and 0.5 g for grass using RNeasy PowerSoil Total RNA Kit following manufacturer instructions (Qiagen, Hilden, Germany). Due to a high amount of organic compounds co-extracted from shrub litter ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We extracted RNA from a total of 348 individuals across two early developmental stages (2 days post fertilization (dpf) and 8 dpf) using RNeasy Mini Kits (Qiagen, Inc.). For 2 dpf libraries ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18 S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Biochemistry 2020Quote: ... 4°C) an applied to a 2 ml Ni-NTA immobilised metal affinity chromatography (IMAC) gravity flow column (QIAGEN, Hilden, Germany). Columns were washed in 10 column volumes (CV ...
-
bioRxiv - Microbiology 2020Quote: ... Each 10 μL uPCR reaction contained 2 μL of DNA template with 1x QuantiTect Multiplex PCR No ROX mastermix (Qiagen™), 0.4 μM each primer ...