Labshake search
Citations for Qiagen :
1501 - 1550 of 5919 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... QuantiTect Primer assays [ACTB (QT00095431) and CDKN1A (QT00062090)] we purchased from Qiagen. ACTB was used for normalization ...
-
bioRxiv - Immunology 2023Quote: ... The 18S reference gene was amplified using QuantiTect Primer Assay Kit (Qiagen). The primers were purchased from Integrated DNA Technologies (Coralville ...
-
bioRxiv - Cancer Biology 2023Quote: ... The primers were designed using the PyroMark Assay Design Software 2.0 (Qiagen) (Supplementary Table S6) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The LPAR1 and LPAR3 Quantitec primers were purchased from Qiagen (#QT00264320, #QT00107709).
-
bioRxiv - Immunology 2024Quote: ... STAT2 and 18s rRNA were measured using validated gene-specific primers (QIAGEN). Primers for ACAT1 ...
-
bioRxiv - Cell Biology 2023Quote: ... and Mm_miR-29c were the miScript primer assays pre-designed by Qiagen. The mature microRNA sequences were 5’UAGCACCAUCUGAAAUCGGUUA for Mm_miR-29a ...
-
bioRxiv - Cancer Biology 2024Quote: ... For two-way qPCR (analysis of MAPK11; Hs_MAPK11_1_SG QuantiTect Primer Assay, Qiagen); cDNA was first synthesised with High Capacity cDNA Reverse Transcription Kit (Fisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... For one-way qPCR (analysis of MAP3K1, Hs_MAP3K1_1_SG QuantiTect Primer Assay, Qiagen); Luna® Universal One-Step RT-qPCR Kit was used ...
-
bioRxiv - Genomics 2019Quote: Two step PCR Each PCR reaction included 25.0 μl of 2X buffer (MultiPlex PCR Master Mix, Qiagen). One microliter each of the 10 pmol forward and reverse primers (Select MultiGEN Diagnostics ...
-
Assessment of salivary microRNA by RT-qPCR: Challenges in data interpretation for clinical diagnosisbioRxiv - Molecular Biology 2024Quote: Q-PCR reactions using miRCURY LNA SYBR Green PCR Kit and miRCURY LNA miRNA PCR Assay (Qiagen) were prepared in 384 multi-well plates ...
-
bioRxiv - Cell Biology 2023Quote: ... mRNA standards for PCR were generated by purifying PCR-product (MinE-lute PCR Purification Kit, Qiagen, Germany) and 10-fold serial dilution.
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified with MinElute PCR purification kit (Qiagen) according to manufacturer’s protocol and eluted in 16 µl of elution buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR products were purified with QIAquick PCR purification kit (Qiagen), ligated to Topo Blunt vector (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... PCR products were purified using the PCR purification Kit (Qiagen) according to the instructions by the manufacturer and sent for Sanger sequencing ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR reactions were purified using MinElute PCR purification kit (Qiagen). Libraries were sequenced using Illumina NextSeq 75 cycle kit with paired-end reads ...
-
bioRxiv - Genomics 2020Quote: ... the PCR products were purified (QIAquick PCR Purification kit, Qiagen), multiplexed ...
-
bioRxiv - Genomics 2020Quote: Quantitative reverse transcription-PCR (qRT-PCR; Rotor-Gene Q; Qiagen) was performed to check the specificity of cDNA products derived from Cap-Seq library preparation ...
-
bioRxiv - Microbiology 2019Quote: PCRs were individually purified using Qiaquick PCR purification kit (Qiagen). The purified products were then analyzed by electrophoresis in 1% precast agarose gels (Sigma).
-
bioRxiv - Genetics 2019Quote: ... PCR products were purified with QIAquick PCR Purification Kit (Qiagen). Amplicons were tagged using NEB Next Ultra II DNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were purified using QIAquick PCR purification kit (Qiagen). The products of restriction enzyme digests were purified by preparative gel electrophoresis followed by QIAquick gel extraction kit (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: ... After concentrating PCR products using a PCR purification kit (Qiagen) they were digested with PacI and AscI and ligated into the BC library vector that had been treated with PacI ...
-
bioRxiv - Genetics 2019Quote: ... PCR aplicons were purified using QIAquick PCR purification kit (QIAGEN), and sequenced in both directions with Sanger method at Source BioScience ...
-
bioRxiv - Immunology 2019Quote: ... The PCR amplicons were generated using PyroMark PCR kit (Qiagen), and quantified using Quant-iT PicoGreen dsDNA reagent (Invitrogen) ...
-
bioRxiv - Genomics 2019Quote: ... PCR products were then purified by PCR purification kit (Qiagen) and subjected to Sanger sequencing (Axil sequencing) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified (QIAquick PCR Purification Kit, Qiagen Inc.) and sequenced using either the 8F or 1492R primer on an ABI Prism 3730 DNA sequencer (Laragen Sequencing and Genotyping ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were purified by PCR purification kit (28104, QIAGEN) and subsequently verified by Sanger sequencing.
-
bioRxiv - Bioengineering 2020Quote: ... and PCR products were desalted (Qiaquick PCR purification kit, Qiagen). Next generation sequencing was performed using an Illumina MiSeq 2×150 bp paired end sequencing (300 cycles) ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR products were purified using a PCR Purification Kit (Qiagen) and sent out for Sanger sequencing ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR products were purified using a PCR Purification Kit (Qiagen) and then used for IVT.
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were purified using QIAquick PCR Purification kit (Qiagen). PCR products were followed by Sanger sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... Overlapping PCR product was purified using PCR purification kit (Qiagen) and subsequently digested using EcoRI and HindIII ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified with QIAquick PCR Purification Kit (Qiagen). The gene Fncas12a of Francisella novicida (Zetche et al ...
-
bioRxiv - Physiology 2021Quote: ... PCR products were purified using QIAquick PCR Purification Kit (Qiagen). Purity and concentration was determined using agarose gel electrophoresis ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR DNA was purified using a PCR purification kit (Qiagen) and sequenced using one of the sgMga#1 sgMga#3 (mouse ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR products were cleaned up by PCR Purification Kit (QIAGEN) and further purified with AMPure XP beads (Beckman A63880) ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR amplification was performed using Taq PCR Core Kit (QIAGEN). Reaction mix contained 20 nM scaffold oligo ...
-
bioRxiv - Neuroscience 2021Quote: ... qRT-PCR was performed using miScript PCR System kit (Qiagen). Reverse transcription was achieved on 1 μg RNA with specific oligo-dT primers to generate cDNA library using this program ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were purified using QIAquick PCR Purification Kits (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... PCR products were purified with QIAquick PCR Purification Kit (Qiagen). Sanger sequencing was carried out for each amplicon using the BigDye Terminator v3.1 Cycle Sequencing Kit and the ABI 3130xl DNA Analyzer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were purified with QIAquick PCR Purification Kit (Qiagen) and the fragment containing hph was subjected to a treatment with Fast DNA End Repair Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... PCR products were purified through QIAQuick PCR purification kit (Qiagen) and subject to library preparation using NEBNext® Ultra™ II DNA Library Preparation Kit (NEB) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were purified using a PCR Purification Kit (Qiagen) and sent out for Sanger sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... PCRs were performed using the Taq PCR Core Kit (Qiagen) as per the manufacturer’s instructions and incorporating Q-solution.
-
bioRxiv - Genetics 2021Quote: ... PCR amplicons were purified using QIAquick PCR purification kit (QIAGEN), and sequenced in both directions with Sanger method at Genewiz ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were purified using a PCR Purification Kit (Qiagen) and sent out for Sanger sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified by QIAquick PCR purification kit (QIAGEN). RNA intermediates were then transcribed using 5X MEGAscript T7 transcription kit (Invitrogen) ...
-
bioRxiv - Genetics 2020Quote: ... PCR products were purified using QIAquick PCR Purification Kit (Qiagen). Barcoded libraries production and Illumina sequencing run were provided by GENEWIZ ...
-
bioRxiv - Genetics 2020Quote: ... PCR products were purified with MinElute PCR Purification Kit (Qiagen), pooled in equimolar ratio ...
-
bioRxiv - Immunology 2020Quote: ... PCR products were purified using a PCR Purification Kit (Qiagen) and amplified fragment sizes were verified on a 2200 TapeStation (Agilent Technologies ...
-
Engineering of a fluorescent chemogenetic reporter with tunable color for advanced live-cell imagingbioRxiv - Molecular Biology 2021Quote: ... PCR products were purified using QIAquick PCR purification kit (Qiagen). The products of restriction enzyme digests were extracted and purified by preparative gel electrophoresis followed by QIAquick gel extraction kit (Qiagen) ...