Labshake search
Citations for Qiagen :
1401 - 1450 of 5919 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... PCR was followed by PCR purification using a QIAquick PCR Purification kit and protocol (Qiagen). About 50 ng of cleaned PCR product of either DENV2 or ZIKV was separately cloned into a TOPO-TA PCR cloning vector (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative reverse transcription PCR (qRT-PCR) was performed using QuantiFast SYBR Green PCR Kit (Qiagen) and a DNA Engine Opticon System (GRI) ...
-
bioRxiv - Cell Biology 2020Quote: ... the PCR products were purified using PCR purification (Qiagen), followed by restriction enzyme digestion ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCRs were purified with the PCR cleanup kit (Qiagen), and subjected to next generation sequencing with sequencing primer TGATTGACTACCCGTCAGCGGGGGTCTTTCA and indexing primer TATACTTTCTAG+A+GAATAGGAACTTCGGAATA+G+GAACT (+N = LNA modification).
-
bioRxiv - Plant Biology 2020Quote: ... 2.0 μL of PCR buffer (Qiagen 10x PCR Buffer), 1.0 μL of DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified QIAquick PCR Purification Kit (Qiagen) and cloned into the pCRII-TOPO-TA vector (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were purified using PCR purification kit (Qiagen) and digested with restriction enzyme KpnI-HF (New England BioLabs ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was cleaned (Qiagen MinElute PCR Purification Kit) and resuspended in water at a desired concentration of 1-2 ug/uL as measured by a Qubit 3.0 dsDNA assay (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR samples were amplified using PyroMark PCR kit (Qiagen). PCR products were sequenced using PyroMark Q48 Advanced CpG reagents on a PyroMark Q48 Autoprep instrument (Qiagen) ...
-
DDK regulates replication initiation by controlling the multiplicity of Cdc45-GINS binding to Mcm2-7bioRxiv - Cell Biology 2020Quote: ... After PCR cleanup with QIAquick PCR Purification Kit (Qiagen), the PCR product was digested with NotI at 37°C for 4 hrs and repurified with a QIAquick PCR Purification Kit ...
-
bioRxiv - Genomics 2019Quote: ... PCR purification was performed using PCR Purification kit (Qiagen). DNA was methylated in vitro using M.SssI methyltransferase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR was performed with the PyroMark PCR Kit (QIAGEN) using 100 ng / μL of DNA according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... PCR products were purified by PCR-cleanup Kit (Qiagen) and sent for Sanger Sequencing (Genewiz) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... PCR products were purified (MinElute PCR kit – Qiagen #28004) and used as template in a transcription reaction to incorporate DIG-labeled nucleotides into an RNA probe (Thermo Fisher MEGAscript T3 Transcription Reaction Kit) ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR products were purified (QIAquick PCR purification kit; QIAGEN) and TOPO-cloned into dual promoter empty vector (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... The purified PCR product (Qiaquick PCR purification kit, Qiagen) was sequenced using the forward primer (Genewiz ...
-
bioRxiv - Physiology 2023Quote: ... The PCR products were purified (Qiagen PCR purification kit) and assembled using the flanking primers ...
-
bioRxiv - Synthetic Biology 2023Quote: ... overnight and PCR purified (Qiagen QIAQuick PCR Purification Kit) the following day ...
-
bioRxiv - Cancer Biology 2024Quote: ... quantified by digital PCR (QIAcuity Digital PCR system, Qiagen) at the Biofidelity R&D facility (Cambridge ...
-
bioRxiv - Immunology 2021Quote: ... and the DNA removed by in-solution DNAse digestion (Qiagen’s RNase-Free DNase Set, #Cat 79254) for 30 minutes at room-temperature ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was isolated from NIH3T3 cells using the FastLane Cell One-Step Buffer Set (Qiagen). The mouse embryo brains at E10.5 were dissected in cold PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... according to manufacturer’s instructions with preceding DNase I digestion with the RNase-Free DNase Set (Qiagen).
-
bioRxiv - Microbiology 2022Quote: ... following the kit instructions and including an on-column DNase treatment (RNase-free DNase set, Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: ... On column DNAse digestion was performed with the RNAse free DNAse set (#79254, Qiagen, Hilden, Germany). RNA was eluted into RNAse-free water (#4387936 ...
-
bioRxiv - Genomics 2022Quote: ... 10 mL chilled Qiagen Buffer C1 (from the Qiagen Genomic DNA Buffer Set, Qiagen no. 19060) and 30 mL chilled ...
-
bioRxiv - Plant Biology 2019Quote: ... The RNA was treated with DNase-treated as per manufacturer’s protocol (RNase-Free DNase Set; Qiagen). The transcripts level was checked by making a comparison of pct1-2 and WT seedlings using two-color hybridizations onto EU-TOM1 microarray slides ...
-
bioRxiv - Molecular Biology 2020Quote: ... The on-column DNase digestion step was performed using the RNAse-Free DNase Set (Qiagen, Germany). The isolated total RNA was quantified using a Qubit 4 fluorometer and the Qubit RNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... the gene set was subsequently uploaded to Ingenuity Pathway Analysis (IPA) database (Qiagen, Redwood City, CA) and analyzed in the context of known biological response and regulatory networks ...
-
bioRxiv - Genomics 2021Quote: ... as recommended by the manufacturer including on column DNase digestion with RNase-Free DNase Set (Qiagen). However ...
-
bioRxiv - Evolutionary Biology 2021Quote: GO enrichment analysis was carried by subjecting gene sets to the Ingenuity Pathway Analysis (IPA) (QIAGEN) and the “Core Analysis” of “Expression Analysis” was performed ...
-
bioRxiv - Genomics 2021Quote: ... contaminating DNA was removed through on-column digestion using the RNase-free DNase I set (Qiagen). RNA purity was assessed using the NanoDrop 6000 ...
-
bioRxiv - Biochemistry 2022Quote: Total RNAs were extracted from AML12 cells as described above with RNase-Free DNase Set (Qiagen). RNA-seq libraries were generated using the NEBNext Globin&rRNA depletion kit and the NEBNext UltraII Directional RNA Library prep kit according to the manufacturer’s instructions (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... An on-column DNAse digestion step was included using the RNAse-free DNAse set (Qiagen #79254) and total RNA was isolated using the miRNeasy® Mini Kit (Qiagen # 217004 ...
-
bioRxiv - Immunology 2022Quote: ... as described in manufacturer’s protocol including an on-column digestion step (RNaseFree DNase Set, Qiagen Inc.). The amount of total RNA was quantified using the Qubit 2.0 Fluorometric Quantitation system (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... as described in manufacturer’s protocol including an on-column digestion step (RNaseFree DNase Set, Qiagen Inc.). RNA was reverse transcribed with Superscript III First Strand Synthesis System (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Post-analysis of the differentially expressed gene set was performed using Ingenuity Pathway Analysis (QIAGEN Inc.) 52.
-
bioRxiv - Molecular Biology 2022Quote: ... DNase treatment of the RNA samples was done on-column using RNase-Free DNase Set (QIAGEN) followed by rRNA-depletion using S ...
-
bioRxiv - Cancer Biology 2023Quote: ... with on-the-column genomic DNA removal performed with the RNase-Free DNase Set (Qiagen #79256). RNA concentration was quantified by NanoDrop Lite (Thermo Fisher #ND-LITE) ...
-
bioRxiv - Genetics 2023Quote: ... Contaminating DNA in the RNA solution was digested using RNase-Free DNase Set (Qiagen, Hilden, Germany). The isolated RNA was purified using an RNeasy Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... but additionally performing DNase digestion on the RNeasy column membrane with RNase-free DNase set (Qiagen) for 30 min after wash by RW1 buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... according to the manufacturer’s instructions and DNase treatment was performed using RNase-free DNase Set (QIAGEN). cDNA was synthesized with SuperScript VILO IV cDNA Synthesis Kit (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... RNA were extracted using an RNeasy Mini-Kit from Qiagen and following the manufacturer’s protocol and including a DNase I (RNase-free DNases set from Qiagen) treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... according to the manufacturer’s instructions and DNase treatment was performed using RNase-free DNase Set (QIAGEN). cDNA was synthetized with iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Immunology 2024Quote: ... 35,57,59,61 RNA purification was performed using a DNase digestion kit (RNase-Free DNase Set, Qiagen 79254), miRNeasy Mini kit for RNA isolation (Qiagen 217004) ...
-
bioRxiv - Plant Biology 2024Quote: ... with subsequent removal of genomic DNA contamination employing the RNase-Free DNase Set (Qiagen, Cat# 79254). RNA-sequencing (RNA-seq ...
-
bioRxiv - Microbiology 2024Quote: ... the DPBS resuspended virion pellet was treated with RNase free DNase Set (Qiagen, Cat. No. 79254) which was neutralized with 10mM Ethylenediamine Tetra-acetic Acid (EDTA ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was reverse-transcribed with the miScript II RT Kit (Qiagen) and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was then synthesized using an Omniscript RT Kit (Qiagen Inc.). Quantitative real-time PCR was performed using SYBR Green PCR Master mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2019Quote: ... Complementary DNA was synthesized by using the Omniscript RT Kit (Qiagen) or SuperScript VILO cDNA Synthesis Kit (Thermo Fisher Scientific ...