Labshake search
Citations for Qiagen :
1451 - 1500 of 1895 citations for KGF 2 FGF 10 Human 171a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Total genomic DNA was extracted from 10 coastal plant species (Table S2) using the Plant DNeasy Mini Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... SYBR green RT-qPCR was performed in triplicate with 10 ng of template cDNA using QuantiTect Master Mix (Qiagen) on a 7900-HT Fast Real-time System (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2020Quote: ... the allantois was dissected out and lysed in 10 μl DirectPCR (Tail) digest reagent (Qiagen, catalog no. 102-T) supplemented with 1 μl of proteinase K overnight at 55°C ...
-
bioRxiv - Genomics 2022Quote: ... 10 budgerigar samples and 12 zebra finch samples) using the DNeasy® Blood & Tissue Kit (Cat. No. 69581, Qiagen). For PCR ...
-
bioRxiv - Microbiology 2020Quote: DNA for metagenomic sequencing was extracted from ~7 g sediment (~0.7 g sediment in 10 individual lysis tubes) using PowerSoil DNA Isolation Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... We eluted purified DNA in 45 µl of EB buffer (10 mM tris-hydrochloride (pH 8.0) (Qiagen, The Netherlands) supplemented with 0.05% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... Second-strand synthesis reaction was carried out in 100 μl using 10 pmol of each primer (HotStarTaq Plus, Qiagen). Residual primers and dNTPs were again degraded enzymatically (ExoSAP-IT ...
-
bioRxiv - Immunology 2021Quote: ... or ectodomain buffer (20 mM Tris, pH 8.5, 500 mM NaCl) and applied to 10 ml Ni-NTA-Sepharose (Qiagen) columns ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were spun at 5000 x g for 10 minutes and supernatant was discarded before resuspension in 1.5 mL QIAzol reagent (Qiagen). Screw-cap tubes were prepared for each sample by adding ∼250 µL of sterile beads and the QIAzol suspension mixture was added and incubated for 5 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was lysed with a lysis buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 20 mM EDTA, 1% SDS) and proteinase K (Qiagen) was added to samples to degrade proteins ...
-
bioRxiv - Systems Biology 2022Quote: ... the bacteria cells were scraped and centrifuged at 3,000g for 10 min and the plasmids were then extracted (Qiagen). Cloning of individual sgRNA base editor construct was based on similar procedure with reduced reagent input.
-
bioRxiv - Molecular Biology 2022Quote: ... The supernatant was loaded onto a 10 mL Ni-NTA Superflow cartridge (connected two 5 mL cartridges) (30761, Qiagen). The cartridge was washed with 100 mL R buffer containing 200 mM NaCl ...
-
bioRxiv - Molecular Biology 2024Quote: ... QT65005) and 10 µM each of forward and reverse primers (listed in Table S2) on Rotor-Gene Q (QIAGEN) with PCR procedures under the following programme ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The lysate was centrifuged at 50,000×g for 10 min and to the supernatant 1 mL of 50% Ni−NTA (Qiagen) was added and incubated for 1 h at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA quality was estimated through total RNA extraction from 10 tissue sections with a RNeasy Plus Mini kit (Qiagen). Thereafter RNA integrity number (RIN ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was extracted from approximately 5-10 million cells from each organ using the RNeasy Mini Kit (QIAGEN). SuperScript® IV Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid transfections were performed in six-well tissue-culture treated dishes at 1.8 × 10^6 cells/ml using Effectene (301427; QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... leaf tissues were collected and homogenized in 400 μL of TPS buffer (100 mM Tris-HCl, 10 mM EDTA, 1 M KCl, pH8.0) using TissueLyser II (Qiagen), followed by incubation for 20 min at 75°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sporophytes and the surrounding maternal calyptra tissue were dissected out of the archegoniophores into 10% RNALater (Qiagen, Hilden, Germany) on Microscope slides with cavities (Marienfeld Superior ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were treated with Angiotensin-II (1 μM) alone or in combination with DAPT (10 μM) or siNotch1 (Qiagen) (50 nM ...
-
bioRxiv - Neuroscience 2023Quote: Sixty 10 μm cryosections of quadriceps muscle snap frozen in liquid nitrogen were collected in QIAzole (Qiagen Cat#79306). Four male and four female wildtype and Col6a2-/- mice were included at two different age groups (5 weeks and 25 weeks old) ...
-
bioRxiv - Cancer Biology 2022Quote: ... after adding 1.0×10^6 copies/µL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Colonic organoids were stimulated with 10% cCM or iCM for 24h prior to lysis and RNA isolation (Qiagen RNeasy). Quadruplicates were sequenced.
-
bioRxiv - Cell Biology 2023Quote: ... Overnight cultures were pelleted at 3,000g for 10 min and plasmid DNA was purified using a Qiagen miniprep kit (27106, Qiagen). Sequences were verified by Sanger sequencing (Eton Bioscience Inc).
-
bioRxiv - Systems Biology 2023Quote: ... x mg solid matrix were mixed with five times the μl amount of ACN:water (1:1, v/v) and homogenised with a TissueLyser II (30 Hz, 10 min; Retsch Qiagen). After a short centrifugation (2 min ...
-
bioRxiv - Microbiology 2023Quote: ... SYBR green real-time PCR assay was carried out in a 20μL PCR mixture volume consisting of 10 μL of 2X Quantitect SYBR green RT-PCR Master Mix (Qiagen) containing HotStarTaq DNA polymerase ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were then incubated in lysis buffer (DPBS with 0.5% Triton X-100, 10 mM MgCl2, 5 mM CaCl2, 100 µg/mL RNAse A (Qiagen)) overnight at 37°C in a water bath to allow capsid maturation ...
-
bioRxiv - Microbiology 2023Quote: ... for 10 minutes at 37°C followed by a final clean-up with Qiagen RNeasy MinElute Kit (Qiagen, #74204) using default manufacturer’s protocol (which keeps RNAs > 200nt ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µg⋅ml –1 Leupeptin and 3 mM Benzamidine) with steel beads at 28.5 Hz for 1 min (Qiagen TissueLyser II ...
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was extracted from 5-10×106 cells using the Gentra Puregene Cell Kit (Qiagen, cat no. 158046) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... doxycycline was added at (0.1 μg/ml, 1 μg/ml (CHRDL2 +) or 10 μg/ml (CHRDL2 ++) RNA was extracted (RNeasy, QIAGEN) and quantified by real-time reverse transcriptase polymerase chain reaction (qPCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 9-10 mL of Buffer BB (1/3 of the lysate volume, From QIAGEN Plasmid Plus Midi Kit) was added ...
-
bioRxiv - Genetics 2024Quote: ... we generated 13 pools of 10 FGOs per genotype in a single well of 8-well strips containing 2.5μl of Buffer RLT (QIAGEN; 79216). Samples were stored in a -80C freezer ...
-
bioRxiv - Biochemistry 2024Quote: ... Overnight cultures were pelleted at 3,000 g for 10 min and plasmid DNA was extracted and purified using a Qiagen miniprep kit (27106, Qiagen). Sequences were verified by Sanger sequencing (Eton Bioscience Inc).
-
bioRxiv - Microbiology 2024Quote: ... The cells were then incubated in lysis buffer (DPBS with 0.5% Triton X-100, 10 mM MgCl2, 5 mM CaCl2, 100 µg/mL RNAse A (Qiagen)) overnight at 37°C in a water bath to allow capsid maturation ...
-
bioRxiv - Plant Biology 2020Quote: ... a 2 ml subsample of the coarse powder was ground to a fine powder using a Qiagen TissueLyser (Qiagen, Germantown, MD). Finely powdered leaf tissue was then sent to Midwest Laboratories (Omaha ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant containing solubilized protein was filtered using a 0.22 μM nylon membrane filter and incubated with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germantown, MD) at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from infected or mock-treated Caco-2 cells using the Qiagen RNAeasy Plus Extraction Kit (Qiagen, Hilden, Germany). For quantifying the SARS-CoV-2 genome abundance in mock and infected samples ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 viruses were purified from the clinical samples by using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The preparations were analyzed by real-time RT–PCR testing for the determination of viral titers of SARS-CoV-2 by standard curve analysis ...
-
bioRxiv - Genomics 2019Quote: ... 200 μl lysis buffer were used per organoid for homogenization at 12,000 x g for 2 min in a QIAshredder Column (Qiagen, Hilden, Germany) after lysis and prior to addition of 70% ethanol ...
-
bioRxiv - Molecular Biology 2020Quote: ... mantle (Ma) and gonad (Go) tissues were collected and individually transferred to 2-mL tubes containing RNA later (QIAGEN, Maryland, USA) separately ...
-
bioRxiv - Plant Biology 2019Quote: ... 50,000 protoplasts in a volume of 100 μL were transformed with 20 μg of each plasmid (2 μg/μL) purified using the Plasmid Maxi kit (Qiagen, Germany). One batch of protoplasts was treated with an equivalent amount of water and used as the negative (untransformed ...
-
bioRxiv - Microbiology 2019Quote: We carried out RNA extraction on a litter aliquot of 0.2 g for shrub and 0.5 g for grass using RNeasy PowerSoil Total RNA Kit following manufacturer instructions (Qiagen, Hilden, Germany). Due to a high amount of organic compounds co-extracted from shrub litter ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We extracted RNA from a total of 348 individuals across two early developmental stages (2 days post fertilization (dpf) and 8 dpf) using RNeasy Mini Kits (Qiagen, Inc.). For 2 dpf libraries ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18 S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Biochemistry 2020Quote: ... 4°C) an applied to a 2 ml Ni-NTA immobilised metal affinity chromatography (IMAC) gravity flow column (QIAGEN, Hilden, Germany). Columns were washed in 10 column volumes (CV ...
-
bioRxiv - Plant Biology 2020Quote: ... by shaking with two 3-mm glass beads for 2 min at 30 Hz with a Tissue-Lyser (Qiagen, Hilden, Germany). After 5 min in an ice-cold ultrasonic bath ...