Labshake search
Citations for Qiagen :
1401 - 1450 of 2752 citations for 7 Bromo 2H 1 3 benzodioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen, NSW, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... 30 mg of sample were aliquoted in Eppendorf tubes and homogenized in 400 mL of methanol for 5 min at 25 Hz with a sample disruptor Qiagen TissueLyser II Laboratory Mixer (Qiagen, Valencia, CA, USA). The homogenized mixture was centrifuged for 10 minutes at 10000g (4 °C) ...
-
bioRxiv - Microbiology 2020Quote: ... followed by lysis in a 2 mL sure-lock tube containing 5 mm stainless steel homogenization beads using the TissueLyser LT (Qiagen, Germantown, MD, USA) for 30 seconds at 30 hz followed by 1 min of 30 hz while keeping the sample cold ...
-
bioRxiv - Microbiology 2019Quote: ... punched papers with faeces or bee samples were homogenized by a stainless-bead (5 mm Ø) in a Tissue Lyser II (Qiagen, Hilden, Germany). Total RNA was eluted in 30 μl RNase-free water and quantified by a Qubit RNA HS kit on the Qubit fluorometer (Thermo fisher scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Intact bacterial cells were pelleted by centrifugation at 10,000 x g for 5 min at room temp and DNA extracted from the pellet using a DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). DNA concentration was assessed by the QubitTM dsDNA BR Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Following the manufacturer’s instructions RNA was reverse-transcribed in a 20 μl reaction volume (42°C, 30 min; 95°C, 5 min) using a QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). cDNA was then amplified using a SYBR Green I Master mix (Roche ...
-
bioRxiv - Genomics 2021Quote: ... we pooled 1.5 mg RNA from each sample (mixed-stage, male-enriched, and starved) and used the RNeasy MinElute Cleanup kit (Qiagen, catalog no. 74204) to further purify and concentrate the pooled RNA ...
-
bioRxiv - Immunology 2022Quote: ... Cells were centrifuged for 5 minutes at 300xg and pellets resuspended in Buffer RLT Plus (RNeasy Plus Mini Kit from Qiagen, Germantown, MD, USA), and frozen at −80°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was extracted from 5 to 10 million cells or 15 to 25 mg of tissue using the MagAttract HMW DNA kit (Qiagen N.V., Venlo, Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... The samples were homogenized with a 5-mm steel bead in a TissueLyser bead mill (Qiagen; operated at 50 Hz for 30 seconds). The homogenized samples were incubated at room temperature for 10 minutes for complete cell lysis and then centrifuged at maximum speed for 5 minutes to pellet insoluble material ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... The aqueous phase was collected and mixed at a 1:1 ratio with 70% ethanol (Qiagen). RNA was isolated from this mixture using the RNeasy MinElute Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 1 μl 10X Buffer (Qiagen). PCR products were digested for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... Cignal EGR-1 reporter kit (Qiagen) was transfected in HEK293T following manufacturer protocol ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... and samples were diluted 1:1 in 70% ethanol and purified using RNeasy columns and reagents (QIAGEN). RNA concentration was measured using a NanoDrop spectrophotometer ...
-
bioRxiv - Systems Biology 2022Quote: ... 12 μl of 1 M Tris-HCl (pH 6.5) and 1 μl RNAse A (Qiagen cat # 19101) were added to the sample and incubated for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: Liver tissue was homogenized in chloroform/methanol (2:1, 1 mL) using TissueLyser (Qiagen Ltd., Manchester, UK). Deionized water (400 uL ...
-
bioRxiv - Evolutionary Biology 2019Quote: We extracted whole genomic DNA from 5 individuals per line using a Qiagen® DNEasy Blood and Tissue Kit (Qiagen, Inc., Valencia, CA, USA), following a modified version of the mouse-tail protocol ...
-
bioRxiv - Genetics 2022Quote: ... 5 μl of each sample was pooled into one of 5 indexed libraries and PCR purified using a QIAquick PCR Purification Kit (Qiagen, Inc., Valencia, CA, USA). Prior to preparing individuals for next generation sequencing ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... with 5 µl proteinase K (20 mg/ml) and lysed overnight at 56°C under shaking in Cell Lysis Solution (Qiagen Gentra Puregen Cell kit) with proteinase K (20 mg/ml) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mL of stabilization mix (RNAprotect Bacteria Reagent - Qiagen diluted with PBS in a 2:1 volume ratio) was applied on plates ...
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned-up using 1:1 of SPRI beads and eluted in 30µl elution buffer (Qiagen). The resulting amplicons were assayed on the Fragment Analyzer System (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ml of the non-stressed culture was added to 1 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Flow-through was mixed 1:1 with 70% ethanol and passed through a RNeasy Mini column (Qiagen, #74104). After centrifugation ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼8 ml PCR product (azide-DNA:2xbiotin-DNA = 1:1) was purified using HiSpeed Plasmid Maxi kit (Qiagen) in 1 ml NaHCO3 (pH 8.3) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA) (Qiagen, Hs_PLCE1_1, SI00115521); negative control siRNA (UUCUCCGAACGUGUCACGUdTdT ...
-
bioRxiv - Microbiology 2020Quote: ... 1× Qiagen Multiplex Master Mix (QIAGEN, Germany) and 5 μL of template DNA in a 15 μL reaction ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing DNase I (1 mg/ml, Qiagen) at 37 °C for 5 min with gentle shaking ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 ml of Proteinase K (Qiagen, 19131) was added to the tube and vortexed for 5 seconds ...
-
bioRxiv - Systems Biology 2022Quote: ... resuspended in 1 mL QIAzol reagent (Qiagen) and stored at -80 °C.
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1 mL of Ni-NTA Agarose (Qiagen) was added to a 15 mL polypropylene gravity flow column (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... and 1 U Taq DNA polymerase (Qiagen). A positive control of DNA extracted from commercially available Agaricus bisporus provided by Dr ...
-
bioRxiv - Genomics 2019Quote: ... and 1 U Taq DNA polymerase (Qiagen). The fungal-specific ITS1F/ITS4 and bacteria-specific 341F/805R primer pairs were used for each sample in two independent PCR reactions ...
-
bioRxiv - Genetics 2019Quote: ... 1×106 cells using RNeasy Kit (Qiagen), followed by DNase digestion using TURBO DNase (Thermo Fisher) ...