Labshake search
Citations for Qiagen :
1451 - 1500 of 2888 citations for 7 Bromo 2H 1 3 benzodioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Amplicons from at least 5 independent PCR products for each sample were pooled together and then purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany). Whenever semi-nested PCR reactions yielded amplicons ...
-
bioRxiv - Neuroscience 2020Quote: ... from APP/PS1 and NTG mice treated with vehicle of CP2 for 14 months (n = 5 per group) were lysed in QIAzol (Qiagen cat. # 79306) followed by RNA isolation using miRNeasy (Qiagen cat ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA was isolated from snap-frozen cortico-hippocampal brain sections from NTG and APP/PS1 mice treated with vehicle or CP2 (n = 5 per group) for 14 months using a DNeasy Blood & Tissue Kit (QIAGEN, cat. # 69504) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: Cells seeded in 6 well plates were grown in 5% FBS to a confluency of 70% before RNA extraction using the RNEasy mini kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... and extracted and amplified from vitrified blastocysts by thawing in phosphate-buffered saline supplemented with 5% bovine serum albumin and processing with REPLI-g whole genome amplification methods (Qiagen, Cat. #150343). Informed consent was obtained from all participants (custodians of the blastocysts ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA synthesis of 100 ng total RNA was performed with miRCURY LNA RT Kit (10 µl volume reaction) which adds a 5’ universal tag of a poly(A) tail to mature miRNA templates (QIAGEN, Germantown, MD). cDNA template was diluted 1:10 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were pelleted at 500 g for 5 min and total RNA was extracted using RNeasy Mini Kit (QIAgen, Cat No. 74104), including DNAse digestion step (QIAgen ...
-
bioRxiv - Neuroscience 2021Quote: ... tMCAO mice at 24 h and 48 h post reperfusion were used for total mRNA isolation according to the protocols of the Isol-RNA Lysis Reagent (5 PRIME, Gaithersburg, USA) and the bead-milling TissueLyser system (Qiagen, Hilden, Germany). QuantiTect® Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2019Quote: ... The long genomic DNA was isolated from 5-10mg tumor core using Gentra Puregene Tissue Kit following the manufacturer’s instructions (Qiagen, Cat. No 158667). Briefly ...
-
bioRxiv - Microbiology 2020Quote: Ticks were homogenised in a 2 ml reaction tube with two 5 mm steel beads and 500 μl PBS using a Tissue Lyser II (Qiagen, Hilden, Germany) for 3 min at 30 Hz ...
-
bioRxiv - Genetics 2020Quote: ... DNA binding plate was incubated with 600 μL of liquid for 4 minutes at RT and centrifuged at 1,300 g for 5 minutes sequentially with PB buffer (Qiagen Cat. No. 19066), followed by PE buffer (Qiagen Cat ...
-
bioRxiv - Biophysics 2020Quote: ... The lysate was cleared by centrifugation at 18000 rpm at 4°C and the supernatant was loaded onto 5 mL Ni–NTA resin (Qiagen, Milan, Italy) equilibrated with binding buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR strips were then incubated for 15 min at 37 °C in a thermocycler and the reaction was stopped by adding 5 μl RLT plus buffer (Qiagen, Cat# 1053393) to each well ...
-
bioRxiv - Cell Biology 2022Quote: ... The remaining lysate was then transferred to 15 ml tubes containing 5 ml lysis buffer and 150 μl Ni-NTA agarose beads (Qiagen, Venlo, Netherlands) and incubated for 4 h at room temperature under constant mild agitation ...
-
bioRxiv - Genomics 2022Quote: ... The mixture was centrifuged at 13,000 rpm for 5 mins and 140 µl of supernatant used for RNA extraction (Qiagen viral RNA kit). The final TNA was eluted in 60 µl of molecular grade water and stored at −80°C.
-
bioRxiv - Microbiology 2023Quote: ... a 1 mL aliquot was sterile filtered and kept to test conditioned media for IL-10 induction (as above)) and replaced with 5 mL of RNA-protect (Qiagen, Cat. # 1018390), mixed by pipetting ...
-
bioRxiv - Plant Biology 2023Quote: ... and pXVE::YFP-cPMEI8 plants treated with control MS and 5 µM estradiol for 24 h using the RNeasy Plant Kit (QIAGEN, Hilden, Germany). For RNA isolation from meristematic and elongation zones ...
-
bioRxiv - Biochemistry 2023Quote: ... gDNA was isolated from 5 x 106 Colo205 cells using the Blood and Cell Culture DNA Maxi Kit (Qiagen, catalog no. 13362) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Tissue RNA was isolated from preserved samples using 30 minutes of automated homogenization at 30 Hz with 5 mm ball-bearings in RLT Plus Lysis Buffer (Qiagen TissueLyser II), RNA was then isolated using a RNeasy Plus Micro Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: Parotid glands were removed from mice (n=5/group) and total DNA was immediately isolated using the DNeasy Blood & Tissue Kit (Ref. No. 69504, Qiagen, Hilden, Germany). DNA samples were diluted with nuclease-free water to a concentration of 10 ng/uL ...
-
bioRxiv - Microbiology 2024Quote: Mosquitoes were homogenised in pools of ≤ ten in 300 µl tissue culture medium using the Qiagen TissueLyser II with 5 mm stainless steel beads (both Qiagen, Manchester, UK) and centrifuged (10,000 rpm/10 min) ...
-
bioRxiv - Neuroscience 2024Quote: ... snap-frozen tissue was processed by adding 500 µl of QIAzol reagent in the presence of one 5-mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using a Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria were then mechanically disrupted using a bead beater homogenizer (PowerLyzer 24, Qiagen; 2 cycles of 45s 5000 rpm / 5 min ice). After an additional 5 min on ice ...
-
bioRxiv - Microbiology 2019Quote: ... Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen, NSW, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... 30 mg of sample were aliquoted in Eppendorf tubes and homogenized in 400 mL of methanol for 5 min at 25 Hz with a sample disruptor Qiagen TissueLyser II Laboratory Mixer (Qiagen, Valencia, CA, USA). The homogenized mixture was centrifuged for 10 minutes at 10000g (4 °C) ...
-
bioRxiv - Microbiology 2020Quote: ... followed by lysis in a 2 mL sure-lock tube containing 5 mm stainless steel homogenization beads using the TissueLyser LT (Qiagen, Germantown, MD, USA) for 30 seconds at 30 hz followed by 1 min of 30 hz while keeping the sample cold ...
-
bioRxiv - Microbiology 2019Quote: ... punched papers with faeces or bee samples were homogenized by a stainless-bead (5 mm Ø) in a Tissue Lyser II (Qiagen, Hilden, Germany). Total RNA was eluted in 30 μl RNase-free water and quantified by a Qubit RNA HS kit on the Qubit fluorometer (Thermo fisher scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Intact bacterial cells were pelleted by centrifugation at 10,000 x g for 5 min at room temp and DNA extracted from the pellet using a DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). DNA concentration was assessed by the QubitTM dsDNA BR Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Following the manufacturer’s instructions RNA was reverse-transcribed in a 20 μl reaction volume (42°C, 30 min; 95°C, 5 min) using a QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). cDNA was then amplified using a SYBR Green I Master mix (Roche ...
-
bioRxiv - Genomics 2021Quote: ... we pooled 1.5 mg RNA from each sample (mixed-stage, male-enriched, and starved) and used the RNeasy MinElute Cleanup kit (Qiagen, catalog no. 74204) to further purify and concentrate the pooled RNA ...
-
bioRxiv - Immunology 2022Quote: ... Cells were centrifuged for 5 minutes at 300xg and pellets resuspended in Buffer RLT Plus (RNeasy Plus Mini Kit from Qiagen, Germantown, MD, USA), and frozen at −80°C ...
-
bioRxiv - Cell Biology 2024Quote: ... The samples were homogenized with a 5-mm steel bead in a TissueLyser bead mill (Qiagen; operated at 50 Hz for 30 seconds). The homogenized samples were incubated at room temperature for 10 minutes for complete cell lysis and then centrifuged at maximum speed for 5 minutes to pellet insoluble material ...
-
bioRxiv - Genetics 2024Quote: ... Biopsies no larger than 5 x 10 x 10mm were washed with ice-cold PBS three times and placed in RNAlater™ (Qiagen, Germantown, MD). After a minimum incubation of 24 hours in RNAlater at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... The aqueous phase was collected and mixed at a 1:1 ratio with 70% ethanol (Qiagen). RNA was isolated from this mixture using the RNeasy MinElute Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 1 μl 10X Buffer (Qiagen). PCR products were digested for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... Cignal EGR-1 reporter kit (Qiagen) was transfected in HEK293T following manufacturer protocol ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...