Labshake search
Citations for Qiagen :
1351 - 1400 of 4884 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... and purified by MinElute PCR purification kit (Qiagen).
-
bioRxiv - Physiology 2020Quote: ... PCR was performed with Taq DNA polymerase (Qiagen). PCR products of correct sizes were extracted and cloned into pGEMT easy vectors (Promega) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the QuantiFast SyBr Green PCR Kit (Qiagen) and the following primers ...
-
bioRxiv - Molecular Biology 2020Quote: The Qiagen SYBR Green PCR kit (Qiagen, Germany) was used for real-time PCR ...
-
bioRxiv - Synthetic Biology 2020Quote: ... purified on a PCR cleanup column (Qiagen 28106), and ligated into BamHI/ HindIII-linearized and gel-purified pET28 ...
-
bioRxiv - Developmental Biology 2021Quote: ... then purified using QIAquick PCR purification kit (Qiagen). Amplicons were sequenced by Sanger sequencing using Exon2seqRev (CCCGCAATTACAACATGCTAG ...
-
bioRxiv - Synthetic Biology 2021Quote: ... purified using the QIAquick PCR Purification Kit (Qiagen) and eluted in 80 µL H2O ...
-
bioRxiv - Bioengineering 2020Quote: ... The resulting PCR amplicons were gel-purified (Qiagen) and processed for Sanger sequencing (Applied Biosystems 3730xL DNA Analyzer).
-
bioRxiv - Neuroscience 2021Quote: ... and the QuantiTect SYBR Green PCR Kit (Qiagen). Sequences of the different primer pairs used for PCR amplification of mouse and rat TPH2 and SERT cDNAs are listed in Supplementary Table S1.
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed using Taq DNA polymerase (Qiagen) and the primers listed in Table S2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μl of Quanti tech probe PCR mix (QIAGEN), 1 μl of Taqman probe (1.5 μM) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were gel-purified (Qiagen, Hilden, Germany), cloned into the non-directional Gateway PCR8 vector (Invitrogen ...
-
Biallelic loss-of-function OBSCN variants predispose individuals to severe, recurrent rhabdomyolysisbioRxiv - Genetics 2021Quote: ... The Rotor-Gene SYBR Green PCR Kit (Qiagen) was used to set up 10 μL reactions containing 1 μL diluted cDNA and 0.8 μM each of forward and reverse primers (OBSCN ...
-
bioRxiv - Immunology 2020Quote: ... purified using a Qiagen PCR cleanup kit (Qiagen), and finally sequenced on an Illumina HiSeq 2500 with a minimum read length of 75 bp to a minimum depth of 30 million reads per sample ...
-
DDK regulates replication initiation by controlling the multiplicity of Cdc45-GINS binding to Mcm2-7bioRxiv - Cell Biology 2020Quote: ... purified with a QIAquick PCR Purification Kit (Qiagen), and ligated with oligos each containing a Cy5- or BHQ-2 label and NotI sticky ends (NEB ...
-
bioRxiv - Genomics 2021Quote: ... or (B) a QIAquick PCR purification column (Qiagen) (proK-col) ...
-
bioRxiv - Cancer Biology 2022Quote: ... purified using the QIAquick PCR Purification Kit (Qiagen), and ligated into BsmBI-digested and dephosphorylated pUSEPR vector using high-concentration T4 DNA ligase (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... and QIAquick PCR purification kit (Qiagen, Hilden, Germany), respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... using SYBR Green PCR Master Mix (204145, Qiagen) on a real time PCR machine (Bio-Rad CFX system) ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Developmental Biology 2022Quote: ... Using the Qiagen minElute PCR purification kit (Qiagen). Purified DNA was quantified using Qubit dsDNA kit (Thermo ...
-
bioRxiv - Plant Biology 2021Quote: ... and QuantiTect SYBR® Green PCR Kits (Qiagen). Gene-specific primers were designed using Primer3 and blast was carried out using NCBI BLAST to determine any miss-priming (Table S1) ...
-
bioRxiv - Microbiology 2020Quote: ... and purified (QIAquick® PCR Purification Kit, Qiagen). The low-copy number vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... on the Rotor-Gene-Q PCR cycler (Qiagen). The concentration of component used in final 25μL PCR reaction mix were as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... and LNA SYBR green PCR kit (Qiagen, 339345). Relative-fold changes were normalized comparing exosomal micro RNA reference gene miR-30c-5p using the primer hsa-miR-30c-5p miRCURY LNA miRNA PCR Assay (Qiagen 339306 ...
-
bioRxiv - Plant Biology 2021Quote: ... using the Quantitec Probe PCR Master Mix (Qiagen) in a 25-µl reaction ...
-
bioRxiv - Microbiology 2021Quote: ... using the QuantiTect Sybr Green PCR kit (Qiagen). PCR conditions were 10 min at 90°C and 40 cycles of 15 s at 95°C and 1 min at 60°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative PCR was performed on a RotorGeneQ (Qiagen) cycler with the SYBR-Green Master mix (Qiagen ...
-
bioRxiv - Biochemistry 2020Quote: ... purified with the QIAquick PCR Purification Kit (QIAgen) and used as DNA templates for run-off in vitro transcription using MEGAscript SP6 kit (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was purified by PCR purification column (Qiagen) and analyzed by qPCR ...
-
bioRxiv - Genomics 2022Quote: ... purified using the QIAquick PCR Purification Kit (Qiagen), and ligated into BsmBI/Esp3I-digested and dephosphorylated pUSEBR ...
-
bioRxiv - Physiology 2022Quote: ... Quantitative PCR (qPCR) was performed for RNU6B (Qiagen) and miR-140 (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 12.5µl of PyroMark PCR Master Mix (Qiagen, France), 2.5µl of CoralLoad concentrate (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was prepared using Quantitect RT- PCR (Qiagen) and RT Q-PCR was performed using the TaqMan Gene Expression Assay (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... QuantiFast SYBR Green RT-PCR Kit (Qiagen, 204156) was used for the qPCR reaction and measurement performed on the 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... The miRCURY LNA miRNA PCR assay system (Qiagen) was used to detect specific miRNA expression ...
-
bioRxiv - Immunology 2020Quote: ... using the miScript SYBR Green PCR kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... cleaned with a PCR clean-up kit (Qiagen) and eluted in TE buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Molecular Biology 2021Quote: ... were purified by MinElute PCR Purification Kit (QIAGEN), and were fragmented by Picoruptor (Diagenode ...
-
bioRxiv - Immunology 2020Quote: ... and QuantiText SYBR Green PCR Master Mix (Qiagen) on a LightCycler 480 Instrument II (Roche) ...
-
bioRxiv - Genomics 2021Quote: ... first using PCR mini-elute purification kit (Qiagen) and then using 2.2x SPRI beads (Beckman-Coulter).
-
bioRxiv - Cancer Biology 2021Quote: ... and ordered miRCURY LNA miRNA PCR Assays (Qiagen; sequences and category numbers available through online data repository (17)) ...
-
bioRxiv - Genetics 2021Quote: ... or the QIAQuick PCR purification kit (Qiagen 28104) and used as a template for in vitro transcription of the sgRNA with the T7 MEGAshortscript™ Kit (ThermoFisher AM1354).
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified using column purification (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... purified with Qiagen MinElute PCR purification kit (Qiagen) and PCR-amplified with 8-9 cycles ...
-
bioRxiv - Plant Biology 2021Quote: ... recovered using a QIAquick PCR purification kit (Qiagen). The ChIP DNA and input DNA were recovered and dissolved in water for ChIP-seq and ChIP-qPCR analysis.
-
bioRxiv - Cancer Biology 2021Quote: ... Amplicons were purified using PCR purification kit (Qiagen) and sequenced by Sanger sequencing ...
-
bioRxiv - Genetics 2021Quote: ... 2X Qiagen Multiplex PCR Master Mix (#206143, Qiagen) and 0.8 μM of primers for ASPA ...
-
bioRxiv - Developmental Biology 2020Quote: ... samples were cleaned with PCR purification kit (Qiagen) between each stage ...