Labshake search
Citations for Qiagen :
1301 - 1350 of 4884 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Total mRNAs were extracted using the Macherey-Nagel RNA easy extraction kit and quantified by qRT-PCR using the QuantiTect SYBR Green qRT-PCR kit (Qiagen) and appropriate primers ...
-
bioRxiv - Genomics 2023Quote: ... The PCR products were pooled and concentrated with ethanol precipitation and further purified using QIAquick PCR purification kit (Qiagen 28106).
-
bioRxiv - Microbiology 2023Quote: ... a single GFP+ or GFP-J-Lat 11.1 cell was sorted directly into each well of a 96-well PCR plate containing the pre-amplification mastermix consisting of 1 μL One-step RT-PCR enzyme (QIAGEN), 5 μL 5× One-step RT-PCR buffer (QIAGEN) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Separation of the PCR products from primers and gel purification was done by QIAquick PCR & Gel Cleanup Kit (Qiagen, Germany). 2-nd PCR (PCR 2 ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated as previously described.8 The cDNA and purified viral DNA were used for quantitative PCR (qPCR) using QuantiTect probe PCR master mix (Qiagen) and optimized concentrations of forward primer (TGTGTGGGAGACCATCAAGC) ...
-
bioRxiv - Cell Biology 2023Quote: ... Transcript-specific primers were designed to span introns and the spcar3 mutation site and used in one-step RT-PCR reactions (210210, OneStep RT-PCR kit, Qiagen). Primer sequences for qRT-PCR are listed in Table 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and class II T7 promoter (transcripts starting with +1A or NAD) were produced by PCR and purified by PCR purification kit (Qiagen) by manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... cDNAs were synthesized using High Capacity RNA-to-cDNA kit (ThermoFischer Scientific) and quantitative RT-PCR were carried out using specific primers (Table S2) and SYBR Green PCR Master Mix (Qiagen). PCR amplification of Gapdh was performed to control for sample loading and normalization between samples ...
-
bioRxiv - Microbiology 2023Quote: ... Triplicate PCRs were carried out in 15 µl reactions containing 1x UCP Multiplex PCR Master Mix (Qiagen, Venlo, The Netherlands), 0.3 μmol l−1 each of the forward and reverse primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR product was treated with 40U Dpn I for 1 hour and was purified by QIAquick PCR Purification Kit (QIAGEN). The purified DNA was quantified by Qubit dsDNA BR kit (Invitrogen).
-
bioRxiv - Microbiology 2024Quote: ... The first PCR was conducted in a 10 μL reaction volume per sample using the Multiplex PCR Plus Kit (Qiagen) with primers 515f/806r (Apprill et al. ...
-
bioRxiv - Immunology 2024Quote: ... TGFβ4 and the chemokine ligand CXCLi2 were measured in these tissue samples by real-time quantitative reverse-transcription PCR (qRT-PCR) using a Rotor-Gene Q version 2.3.1.49 (Qiagen, West Sussex, UK) as previously described by (Humphrey et al 2014).
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was obtained and amplified in a first-round PCR (RdRpS1 5’-GGKTGGGAYTAYCCKAARTG-3’, RdRpR1 5’-TGYTGTSWRCARAAYTCRTG-3’) using One-Step RT-PCR Enzyme MixKit (Qiagen) with the total expected size of 602 base pairs (bp) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were then analyzed on 1% agarose gel and purified using the QIAquick PCR Purification Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions.
-
bioRxiv - Systems Biology 2024Quote: ... Transcribed cDNA was diluted fivefold and used for real-time quantitative PCR with QuantiTect SYBR Green PCR Kit (204145; Qiagen). Comparative Ct (ΔΔCt ...
-
bioRxiv - Genomics 2024Quote: ... RNA was first amplified using a first-round PCR (RdRp S1 5ߣ-GGKTGGGAYTAYCCKAARTG -3’, RdRp R1 5’-TGYTGTSWRCARAAYTCRTG-3’) with the One-Step RT-PCR Enzyme MixKit (Qiagen), targeting a total expected size of 620 base pairs (bp) ...
-
bioRxiv - Genetics 2024Quote: ... The PCR was conducted in 10μL reactions containing 4μL of 2X Qiagen multiplex PCR buffer mix (QIAGEN Inc., Hilden, Germany), 0.25μM of primer mix ...
-
bioRxiv - Zoology 2024Quote: ... Multiplex PCR was performed in 10 µl reaction volume containing 5 µl 2x QIAGEN Multiplex PCR Master Mix (QIAGEN, Germany), 2 µl 5x Q-Solution (QIAGEN) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 75 ng of rRNA was reverse transcribed and amplified with 8 PCR cycles using the OneStep RT-PCR kit (Qiagen) and primers MS2_quant_F and MS2_quant_R (Supplemental Table 8) ...
-
Vegetative nuclear positioning is required for calcium and ROS signaling in Arabidopsis pollen tubesbioRxiv - Plant Biology 2020Quote: ... purified with the QIAquik PCR Purification kit (Qiagen) and subsequently ligated into a pH2GW7 vector (Takagi et al. ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and PCR purification kits were obtained from QIAGEN. All primers and oligos were synthesized from Integrated DNA Technologies ...
-
bioRxiv - Biophysics 2020Quote: ... were purified using a PCR purification kit (Qiagen).
-
bioRxiv - Cell Biology 2020Quote: ... using the Quantitect SYBR Green PCR kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... purified using the QIAquick PCR Purification Kit (Qiagen), and resolved on a 0.8% EtBr–agarose gel ...
-
bioRxiv - Microbiology 2020Quote: ... using One Step RT-PCR kit (Qiagen, Germany) and its larger portion was amplified for phylogenetic analysis by self designed primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... purified using a QIAquick PCR purification kit (Qiagen) and sequenced by the Source Bioscience Sanger Sequencing Service ...
-
bioRxiv - Microbiology 2021Quote: ... followed by column purification (PCR Purification Kit, Qiagen) and elution in 200ul EB buffer.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Purified PCR products were cloned into pDrive (Qiagen) and sequenced by Eurofins Genomics (Ebersberg ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... purified using the QIAquick PCR purification kit (QIAGEN) and circularized with T4 DNA ligase ...
-
bioRxiv - Immunology 2022Quote: ... The DNA was purified (QIAquick PCR cleanup, Qiagen). The relative amounts of the genes that were precipitated by each antibody were measured by qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... and purified with the PCR cleanup kit (Qiagen). Half of the eluate was redigested with NheI and half with PvuII (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was purified (MinElute PCR Purification Kit, Qiagen) and stored at −80°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... MiRNA-specific PCR primers were purchased from Qiagen (miR-98-5p ...
-
bioRxiv - Genomics 2020Quote: ... followed by the MiniElute PCR purification kit (Qiagen). The quality of DNA was assessed using a 2100 Bioanalyzer instrument (Agilent) ...
-
bioRxiv - Molecular Biology 2021Quote: ... employing the QuantiTect SYBR Green PCR Kit (Qiagen). Each sample was analyzed in triplicates for transcript levels - given as cycle threshold (Ct ...
-
bioRxiv - Molecular Biology 2021Quote: ... and purified by MinElute PCR purification kit (Qiagen).
-
bioRxiv - Physiology 2020Quote: ... PCR was performed with Taq DNA polymerase (Qiagen). PCR products of correct sizes were extracted and cloned into pGEMT easy vectors (Promega) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the QuantiFast SyBr Green PCR Kit (Qiagen) and the following primers ...
-
bioRxiv - Molecular Biology 2020Quote: The Qiagen SYBR Green PCR kit (Qiagen, Germany) was used for real-time PCR ...
-
bioRxiv - Synthetic Biology 2020Quote: ... purified on a PCR cleanup column (Qiagen 28106), and ligated into BamHI/ HindIII-linearized and gel-purified pET28 ...
-
bioRxiv - Developmental Biology 2021Quote: ... then purified using QIAquick PCR purification kit (Qiagen). Amplicons were sequenced by Sanger sequencing using Exon2seqRev (CCCGCAATTACAACATGCTAG ...
-
bioRxiv - Synthetic Biology 2021Quote: ... purified using the QIAquick PCR Purification Kit (Qiagen) and eluted in 80 µL H2O ...
-
bioRxiv - Bioengineering 2020Quote: ... The resulting PCR amplicons were gel-purified (Qiagen) and processed for Sanger sequencing (Applied Biosystems 3730xL DNA Analyzer).
-
bioRxiv - Neuroscience 2021Quote: ... and the QuantiTect SYBR Green PCR Kit (Qiagen). Sequences of the different primer pairs used for PCR amplification of mouse and rat TPH2 and SERT cDNAs are listed in Supplementary Table S1.
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed using Taq DNA polymerase (Qiagen) and the primers listed in Table S2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μl of Quanti tech probe PCR mix (QIAGEN), 1 μl of Taqman probe (1.5 μM) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were gel-purified (Qiagen, Hilden, Germany), cloned into the non-directional Gateway PCR8 vector (Invitrogen ...
-
Biallelic loss-of-function OBSCN variants predispose individuals to severe, recurrent rhabdomyolysisbioRxiv - Genetics 2021Quote: ... The Rotor-Gene SYBR Green PCR Kit (Qiagen) was used to set up 10 μL reactions containing 1 μL diluted cDNA and 0.8 μM each of forward and reverse primers (OBSCN ...