Labshake search
Citations for Qiagen :
1151 - 1200 of 2131 citations for 5 Bromobenzothiazole 2 sulfonic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... 2×106 MDSCs were used for RNA extraction using the Rnaeasy Plus Kit (Qiagen # 4134), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... 2 µL of sonicated RNA per sample was purified with miRNeasy Micro Kit (Qiagen, 217084) and treated with DNase I (Qiagen ...
-
bioRxiv - Developmental Biology 2024Quote: ... 15 mM DTT) and then treated with 2 μL of 4 mg/mL Protease (QIAGEN) by incubation at 55°C for 6 hours ...
-
bioRxiv - Microbiology 2022Quote: ... LF/LF = 5 mice from two cages over two experiments) using the DNeasy PowerSoil Kit (Qiagen, Germantown, MD). Modifications to the standard protocol included a 10-minute incubation at 65°C immediately following the addition of the lysis buffer and the use of a bead mill homogenizer at 4.5 m/s for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA-Seq libraries were prepared from 5 ng total RNA using the NEB Next RNA Ultra Kit (QIAGEN) with poly(A ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Microbiology 2021Quote: ... 20 mM imidazole was added to the supernatant and incubated with 5 mL of Ni-NTA resin (Qiagen) with a stirring magnet at 4°C for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Immunology 2022Quote: ... and 5 cells per well were sorted into a 96-well plate containing TCL buffer (Qiagen, cat. 1031576) with 1 % beta- Mercaptethanol and snap frozen on dry ice ...
-
bioRxiv - Biophysics 2022Quote: ... The suspension was spun down at 16,000 r.c.f at 4 °C for 30 min and the supernatant was applied 5 ml Ni-NTA resin (Qiagen)/ L culture medium ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... total DNA from 5 × 105 J-Lat cells was purified using Qiagen blood mini kit (Qiagen, Hilden, Germany) and quantitated spectrophotometrically ...
-
bioRxiv - Microbiology 2021Quote: ... prior to the addition of proteinase K and 5 μl of 100 mg ml−1 RNase A (Qiagen). The DNA concentration was determined using a Qubit fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was isolated from 5 × 105 cells with the AllPrep© DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA for expression analyses was extracted from 5 day-old protonemata using a RNeasy Plant Mini Kit (Qiagen). Genomic DNA removal and cDNA synthesis were performed with a Quantitect Reverse Transcription kit (Qiagen).
-
bioRxiv - Developmental Biology 2021Quote: Log fold-change values of the top 5% proteins were used as input for Ingenuity Pathway Analysis (Qiagen: https://digitalinsights.qiagen.com/products/features/) ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted from 5×106 cells per sample using the AllPrep DNA/RNA/miRNA Universal Kit (QIAGEN) according to manufacturer’s recommendations with additional DNase I treatment for RNA extraction ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... A 5 ml aliquot of culture was removed and added to 10 ml of RNAprotect Bacteria Reagent (Qiagen) and mixed by vortexing ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Plant Biology 2023Quote: Total RNA from 5-day-old whole plants was extracted using the RNeasy Plant Mini Kit (Qiagen, 74904). For RNA-seq ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 5-10 g of soil per sample with the DNeasy PowerMax Soil Kit (Qiagen) and used for short read and long read sequencing ...
-
bioRxiv - Physiology 2023Quote: ... a 5 mg piece of kidney tissue was homogenized in 350 μL of RNeasy RLT Lysis buffer (Qiagen) containing 2-mercaptoethanol and centrifuged at maximum speed for 3 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Edmund Bühler) by bead beating twice for 5 min at 30 Hz in a Tissue Lyzer II (QIAGEN). Lysates were then incubated for 30 min at 37 °C with shaking ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR amplification was carried out in 5 µl reactions using the QIAGEN Multiplex PCR Kit (QIAGEN, Germany). Each sample reaction contained 10–20 ng of genomic template DNA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). The remaining 95 mL of culture was combined with 40.7 mL 50% glycerol (v/v) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Glycerol was added to the remaining culture to a final concentration of 15% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were eluted using an imidazole gradient and subsequently loaded onto a 5 ml StrepTactin Superflow Cartridge (Qiagen) at a flow rate of 0.8 ml/min ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Immunology 2023Quote: RNA was purified from at least 5 x 104 CD4+ T cells using the RNeasy Micro kit (Qiagen). cDNA was synthesized using the SuperScriptTMVILOTMcDNA synthesis kit (Invitrogen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Complementary DNA of microRNAs was synthesized from 5 μg total RNA using microRNA-specific primers (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Genomic DNA was eluted from the column using 5 mL of prewarmed (50°C) QF Buffer (Qiagen, Germany). DNA was precipitated by adding 0.7 volumes of isopropanol ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from the Sterivex filters (i.e., 0.22–5 μm size fraction) using an AllPrep DNA/RNA Mini Kit (80204; Qiagen) with a modified protocol ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from 5-10 snap-frozen larvae with the RNeasy Mini kit (Qiagen cat no. 74104) and reverse-transcribed using QuantiTect Reverse Transcription kit (Qiagen cat no 205311 ...
-
bioRxiv - Immunology 2022Quote: Total RNA from ~ 5 × 105 neutrophils (CD45+Lin-CD11b+Ly6G+) was isolated with the RNeasy micro kit (Qiagen) and RNA quality was checked with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: ... Sequences with an E-value lower than 1e-5 were used for multiple sequence alignment using CLC v 21.0.5 sequence manager (Qiagen). After multiple rounds of alignments and manual removing non-nAChR sequences a set of 2047 proteins were obtained ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Biochemistry 2023Quote: ... High speed supernatant (HSS) was then batch bound to 5 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) resin at 4ºC for 2 hours stirring in a beaker ...
-
bioRxiv - Developmental Biology 2023Quote: ... Plates were then placed at 4 0C before adding the reverse transcription mix containing 5’-biotinylated TSO (Qiagen). PCR products were cleaned up using 0.8:1 Ampure XP beads (Beckman Coulter ...
-
Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryobioRxiv - Developmental Biology 2024Quote: ... Single blastocysts were collected from the M2 drop in 5 µL of 1x TCL lysis buffer (Qiagen #1031586) containing 1% (v/v ...
-
bioRxiv - Neuroscience 2024Quote: ... Each of the wells that the nuclei were sorted into contained 5 uL of EB buffer (Qiagen, 19086), 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs ...
-
bioRxiv - Bioengineering 2024Quote: ... with ∼5-10 mg of each organ homogenized into 300 μL homogenization buffer using stainless steel beads (Qiagen) in a TissueLyser II tissue homogenizer (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was extracted from 3 – 5 x 106 cells using Rneasy kit with Dnase I treatment (QIAGEN), following manufacture instructions ...
-
bioRxiv - Cancer Biology 2024Quote: Total marrow cells were pelleted at 400g for 5 minutes and resuspended and vortexed in RLT buffer (Qiagen) supplemented with 1% beta-mercaptoethanol prior to storage at −80°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Pellets were then incubated for 3 h at 37°C with 2ml of 5 mg/ml SDS in 75 mM Tris pH 7.5 with 0.33 mg/ml proteinase K (Qiagen). At this point ...
-
bioRxiv - Cell Biology 2020Quote: All muscles were homogenized 2 × 30 sec at 30 Hz using a Tissuelyser II (Qiagen, USA) in ice-cold homogenization buffer (10% (v/v ...
-
bioRxiv - Plant Biology 2020Quote: Total DNA was isolated from 2-3 weeks old seedlings with DNeasy Plant Mini Kit (QIAGEN). 1ng of DNA per qPCR reaction was used as template ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg total RNA was used for cDNA synthesis using an Omniscript Reverse Transcription Kit (Qiagen). For the quantitative real-time PCR ...
-
bioRxiv - Microbiology 2021Quote: ... except that 2 mL prefilled PowerBead tubes (glass beads, 0.1 mm; Cat no. 13118-50, Qiagen) were used for the bead beating ...