Labshake search
Citations for Qiagen :
951 - 1000 of 2131 citations for 5 Bromobenzothiazole 2 sulfonic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: Saos-2 cells RNA was extracted using RNeasy mini kit (Qiagen, Catalog#:74104). and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... in a 2 mL centrifuge tube for 3 min using a TissueLyzer (Qiagen). The obtained mixture was serially diluted in 5.0 mL sterile phosphate buffer and 150 µL aliquots of 10−4 to 10−7 dilutions were spread onto plates containing a range of media ...
-
bioRxiv - Genetics 2020Quote: ... with the addition of a homogenization step using a TissueLyser 2 homogenizer (Qiagen) with a 4-mm steel bead ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...
-
bioRxiv - Molecular Biology 2022Quote: ... 400 cotyledons were ground in 2 ml tubes using a Tissue Lyser (Qiagen) for 2 x 1 min at 30 Hz ...
-
bioRxiv - Microbiology 2023Quote: ... cultures were mixed with 2 volumes of pre-cooled RNAprotect Bacteria Reagent (Qiagen), and cells were collected by centrifugation (5 min at 4000 × g at 4 °C) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Genomics 2023Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen, no. 30250) and kept on a rotator at room temperature for 1 h.
-
bioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 2 mL of RNAprotect bacterial reagent (Qiagen; 76506) and incubated at room temperature for 5 minutes prior to storage at - 80°C until further processing ...
-
bioRxiv - Microbiology 2023Quote: ... and the supernatant was loaded onto 2 ml Ni-NTA Superflow resin (Qiagen). The resin was washed once with 10 mL resuspension buffer and three times with 10 mL resuspension buffer supplemented with 30 mM imidazole ...
-
bioRxiv - Molecular Biology 2022Quote: ... homogenized for 2 cycles with a Bead Beater TissueLyser II (Qiagen, Germantown, MD) at 30 Hz for 3 min each ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2024Quote: ... (NM-2) one negative control for the kit DNeasy Blood and Tissue (Qiagen) used for DNA extraction of minipig blood and (NM-3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... for Day 0 and 2 analyses or AllPrep DNA/RNA Mini Kit (Qiagen) for Day 4 and 6 analyses ...
-
bioRxiv - Neuroscience 2023Quote: ... The tissue was fully homogenized in 2 ml of QIAzol buffer reagent (Qiagen) on ice and Dounce homogenization ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 2-mercaptoethanol and then purified using the RNeasy mini kit (QIAGEN) for the QIAcube connect (QIAGEN ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR-2 products were pooled based on concentrations from capillary electrophoresis (QIAxcel, Qiagen). Final libraries were quantified by Qubit dsDNA High Sensitivity assay (ThermoFisher ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Biochemistry 2022Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with 50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA (2 μg) was treated with bisulfite (EpiTect Bisulfite Kit, Qiagen, Hilden, Germany). The modified DNA was amplified using primers specific for methylated or unmethylated MGMT gene promoters ...
-
bioRxiv - Cancer Biology 2023Quote: ... consisting of 10 μl of 2× QuantiNOVA SYBR Green PCR master mix (Qiagen), 7.2 μL nuclease-free water ...
-
bioRxiv - Cell Biology 2023Quote: ... Ishikawa and Caco-2 cell lines were transfected with 20 nM siRNA (Qiagen) using JetPRIME (Polyplus Transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were resuspended in 2 mL of RNAprotect bacterial reagent (Qiagen; 76506) and incubated at room temperature for 5 minutes prior to storage at - 80°C until further processing ...
-
bioRxiv - Microbiology 2024Quote: ... products were digested with restriction enzymes (Table 2) and purified (Qiagen PCR purification). Following triple ligation into pJB38 ...
-
bioRxiv - Microbiology 2024Quote: ... Data were analyzed by the 2-ΔΔCT method using HPRT and GAPDH (Qiagen) as control genes and expressed as fold change compared to control cells without bacteria ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were harvested 2 days later using RNEasy Plus Mini Kit (Qiagen, 74134) with QIAshredder (Qiagen ...
-
bioRxiv - Pathology 2024Quote: ... 2) TRIzol method versus TRIzol method plus RNeasy clean-up (QIAGEN, Hilden, Germany).
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Developmental Biology 2021Quote: ... were first frozen in liquid nitrogen and then homogenized with a 5 mm ∅ metal bead (Qiagen) for 2 min at 40 Hz using TissueLyser LT (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... using stainless steel beads (5 mm mean diameter) and a TissueLyser LT adapter (Qiagen, Hilden, Germany) for 5 min at 50 Hz ...
-
bioRxiv - Immunology 2021Quote: ... the supernatant/Sepharose bead slurry was passed through a 5 ml polypropylene gravity flow column (Qiagen). The column was washed with 1 column volume of PBS before being eluted with 9 ml of Elution Buffer (0.1M Glycine/HCl buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... and resuspended in 10 mM Tris pH8 (500 μL) with 5 μL RNase A (Qiagen 19101) for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131 ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the tube together with a 5 mm stainless steel bead (Qiagen, Maryland, USA). The sample was homogenized for two minutes at 30 Hz using a TissueLyser II (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... small RNA-enriched total RNA was treated twice with 5 μl of RNase-free DNase (Qiagen) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Immunology 2020Quote: ... The bacterial lysates were mixed for 1 h with 5 ml of Ni-NTA resin (Qiagen) that had been equilibrated with buffer A ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Microbiology 2021Quote: ... sorokiniana were ground with two stainless steel beads (5 mm) using a TissueLyser (Qiagen, Hilden, Germany) at 30 Hz for 1 minute at room temperature and soaked in 1 ml of 100 mM sodium acetate buffer pH 5.0 at 70°C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 50 mM Tris pH 8.0) using 5 mM stainless steel beads in a TissueLyser II (Qiagen). In vitro TPP1 assay was performed as described ...
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified lysate was applied to two tandemly-connected 5 ml Ni-NTA Superflow cartridges (Qiagen); the cartridges were washed with buffer containing 20 mM Tris pH 8.0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... sections were incubated in 0.08 M KOH for 5 min and washed by Buffer EB (Qiagen). Then ...
-
bioRxiv - Microbiology 2020Quote: ... The proteolysis reaction products were then passed over a 5 mL Ni-NTA superflow cartridge (Qiagen) to remove TEV and uncleaved protein ...