Labshake search
Citations for Qiagen :
1351 - 1400 of 2131 citations for 5 Bromobenzothiazole 2 sulfonic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... DNA was isolated from 1-2 mm tail tissue using the DNeasy Blood and Tissue Kit (Qiagen) following the protocol for isolation of DNA from animal tissues and was eluted in 100 µl H2O ...
-
bioRxiv - Genetics 2020Quote: ... RNases were removed by incubating samples in the presence of 2 ul of RNase A (Qiagen, 158922) for 30 min at 37°C and samples were chilled for 5 on ice ...
-
bioRxiv - Microbiology 2021Quote: Enrichment for viral RNA was performed using the QIASeq™ SARS-CoV-2 Primer Panel V2 (Qiagen) Panel V2 ...
-
bioRxiv - Cancer Biology 2021Quote: Liver tissue was homogenized in chloroform/methanol (2:1, 1 mL) using TissueLyser (Qiagen Ltd., Manchester, UK). Deionized water (400 uL ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNA oligonucleotides targeting Arf1 and IRSp53 were purchased from Qiagen (Flex-iTube GeneSolution GS375 for Arf1; siArf1#1 Cat. No. SI02654470; siArf1#2 Cat. No. SI00299250; Qiagen Flex-iTube IRSp53 siRNA#1 Cat ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... SARS-CoV-2 replication was quantified via RT-qPCR using the QuantiTect Multiplex RT-qPCR Kit (Qiagen) with a Rotor Gene Q cycler (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... and 6.25mL 2-mercaptoethanol (βME)) and homogenized at 30Hz for 3 min in a TissueLyzer II (Qiagen). 60 μL of 100% isopropanol was added to each tube and incubated for 1 min ...
-
bioRxiv - Immunology 2021Quote: ... Chromatin was transferred to fresh tubes and incubated with 2 μl RNase A (Qiagen, 20 mg/ml) and 6 μl 5M NaCL (Active Motif ...
-
bioRxiv - Genomics 2021Quote: ... in a 20 μL system with a mixture of 10 μL 2×SYBR Premix ExTaq (Qiagen, Germany), 2.0 μL diluted cDNA or double distilled water as a negative control ...
-
bioRxiv - Immunology 2021Quote: ... Viral RNA was extracted from VSV-SARS-CoV-2 S mutant viruses using RNeasy Mini kit (Qiagen), and the S gene was amplified using OneStep RT-PCR Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products between 200bp-600bp were purified from 2% agarose gels run in 0.5XTAE using QIAquick kits (Qiagen), and excess adaptors were removed by magnetic beads (HighPrep PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cotyledons from 100 plants were dissected and ground in 2 ml tubes using a Tissue Lyser (Qiagen) for 1 min 30 sec at 30 Hz before RNA extraction using the RNeasy micro kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 mM Tris pH 8.5, 2 mM MgCl2, 0.5% NP40, 0.5% Tween20, 0.05 U/mL QIAGEN protease) and following the procedure described in (42) ...
-
bioRxiv - Microbiology 2023Quote: ... Primers for Jamaican fruit bat genes (Supplemental Table 2) and qPCR was performed (QuantiTech SYBR Green, Qiagen). Within sample gene normalization was performed on Rps18 (ΔCq) ...
-
bioRxiv - Biophysics 2023Quote: ... The filtered supernatant was loaded onto 2 gravity columns each with 4 mL Ni-NTA agarose (Qiagen). The resin was pre-equilibrated with the lysis buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was passed three times through 2 mL of pre-equilibrated Ni-NTA Agarose beads (Qiagen) in a gravity flow column and then washed with 300 mL of lysis buffer D ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was then performed in a 20 μL reaction volume with 2×SYBR Green qPCR mix (Qiagen), 100 nM each of the sense and antisense primers (Table 1) ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was extracted from 2 to 4 ml of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Physiology 2022Quote: ... Fifteen milligrams of liver were homogenized in 200 µL of a 3:3:2 solution of acetonitrile:isopropanol:water (MeCN:IPA:H2O) in ceramic bead tubes (1.4 mm, Qiagen #13113-50) using a TissueLyzer II (Qiagen #85300) ...
-
bioRxiv - Pathology 2022Quote: ... HSP90AB1) and fold changes/regulation of gene expression were calculated using the 2^(−ΔΔCT) formula (GeneGlobe, QIAGEN). Differential expression (up and down regulation ...
-
bioRxiv - Cell Biology 2022Quote: Amplicons were separated on 2% agarose-TAE gels and purified using the QIAquick Gel Extraction Kit (Qiagen). Amplicons were sequenced at Quintarabio ...
-
bioRxiv - Microbiology 2024Quote: ... 2 g of soil were used for RNA extraction using the RNeasy PowerSoil Kit (Qiagen, Venlo, Netherlands) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: ... 2 or 4 days and genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). Bisulfite converted DNA libraries were prepared using the Accel-NGS Methyl-Seq DNA library kit (SWIFT BIOSCIENCES) ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mL of culture (0′) was removed and mixed with 2 mL of RNAprotect Bacterial Reagent (QIAGEN), vortexed ...
-
bioRxiv - Molecular Biology 2023Quote: ... The soluble fraction was collected and incubated with 2 mL of Ni-NTA Superflow affinity resin (Qiagen), previously equilibrated with lysis buffer ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from pools of 2-3 organoids using RNeasy Plus Mini Kit (Qiagen, #74134) according to the manufacturer’s protocols ...
-
bioRxiv - Synthetic Biology 2022Quote: ... first the filter-harvested cells were resuspended in 2 mL RNAprotect Bacterial Reagent (Qiagen Catalog no. 76506), then pelleted in a centrifuge ...
-
bioRxiv - Immunology 2022Quote: ... the frozen lung specimens were weighed before homogenization in PBS/2% FBS solution using the TissueLyser (Qiagen), as previously described (Tseng et al. ...
-
bioRxiv - Genomics 2022Quote: ... Samples were incubated overnight at 55°C before adding 2 µl of RNaseA (100 mg/ml, Qiagen) and incubated for 15 min at 45°C ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were homogenized (2 x 1 min at 30 Hz) by a TissueLyser (Qiagen, Hilden, Germany) and stored at -20 °C until next step ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA was extracted from the PBMC obtained from 2 alpacas using standard RNA extraction kit (Qiagen). Recovered mRNA was retrotranscribed to cDNA by using Supercript IV (ThermoFischer ...
-
bioRxiv - Biochemistry 2022Quote: IQN17 was crystallized at room temperature in a hanging-drop vapor diffusion system by mixing 0.3 μL of 15 mg/mL peptide with 0.3 μL of reservoir solution containing 0.1 M imidazole (pH 8.0) and 35 % 2-methyl-2,4-pentanediol (MPD) (Qiagen). Crystals were seen two days after trays were set up ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted from 2 biological replicates of fecal pellets using DNeasy PowerLyzer PowerSoil kit (Qiagen). Concentration of Pc and Bt DNA was assessed using species-specific qPCR primers (Key Resources Table) ...
-
bioRxiv - Genetics 2024Quote: ... the final pool was purified from a 2% agarose gel (QIAEX II Gel Extraction Kit, Qiagen #20021).
-
bioRxiv - Microbiology 2024Quote: ... approximately 1 × 109 CFU of bacteria were mixed at a 2:1 (vol:vol) ratio of RNAProtect (Qiagen) and incubated at room temperature for 5 min ...
-
bioRxiv - Immunology 2024Quote: mTEC subpopulations were sorted and lysed in 20µl Lysis Buffer (0.02% 2-ME in 2x TCL (Qiagen)) using BD FACSAria TM III cell sorter (BD) ...
-
bioRxiv - Microbiology 2024Quote: ... then homogenised with a steel ball for 2 minutes at 25 Hz using a Tissue-Lyser (Qiagen). CFU was quantified by plating to MacConkey agar containing 50 ug / ml streptomycin.
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was extracted at 2 or 8 hpi with DNeasy Blood/Tissue DNA mini kit (Qiagen) and quantitated by a nanodrop spectrophotometer ...
-
bioRxiv - Molecular Biology 2024Quote: ... filtered and incubated with Ni-NTA Agarose (Qiagen, 1 mL slurry per 2 L of cell culture) for 1h ...
-
bioRxiv - Plant Biology 2024Quote: ... Each extraction step was carried out for 2 h in a TissueLyser II (Qiagen AB, Sollentuna, Sweden) at 6 s-1 at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... and centrifuged (2 minutes 12,000 RPM) before DNA-containing supernatant (2µL) was added to PCR master mix (18µL, Qiagen 201203 ...
-
bioRxiv - Bioengineering 2024Quote: ... plasmids were purified from the 2-mL culture and eluted using 50 µL EB buffer from QIAGEN. The concentration usually was 50 ng/µL ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 2 hours at 37°C and subsequently purified using the QIAquick PCR Purification Kit (Qiagen, 28106). The modified lentiGuide-puro vector (Addgene Plasmid #52963 ...
-
bioRxiv - Cell Biology 2024Quote: ... with 2-mercaptoethanol and stored at -80 °C until purification with a RNeasy Plus Micro Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... each mock community (Supplementary Table 2) was extracted with EZ1 DNA Tissue Kit (Qiagen; 953034; EZ1 method) and a separate aliquot with TRI Reagent® (Zymo Research ...
-
bioRxiv - Plant Biology 2020Quote: Quantitative real-time PCR was performed in a volume of 5 mL QuantiTect Probe PCR Kit (Qiagen GmbH, Hilden, Germany) kit and an ABI 7900HT fast real-time PCR system (ThermoFisher Scientific Inc. ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was collected and subjected to affinity purification using 5 mL Hi-Trap column containing Ni-NTA resin (Qiagen) on an AKTA Pure 25L protein purification system (GE Healthcare) ...
-
bioRxiv - Biochemistry 2021Quote: ... and cDNA products containing the R2R adapter attached to their 5′ end were cleaned-up by using a MinElute column (Qiagen) to remove unused primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genetics 2021Quote: ... and E11 (5’-AGGAAAAAGGAAATAAATTA-3’) primers on pDH373 as a template generated a smaller fragment that was cleaned up by QIAGEN MinElute PCR Purification Kit (#28004) ...