Labshake search
Citations for Qiagen :
1051 - 1100 of 10000+ citations for Tonsoku Like DNA Repair Protein TONSL Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and DNA isolation using the QIAamp Blood DNA Mini Kit according to manufacturer instructions (Qiagen). Real Time-quantitative PCR (RT-qPCR ...
-
bioRxiv - Microbiology 2021Quote: Total genomic DNA was isolated using the MagAttract® HMW DNA kit (Qiagen, Hilden, Germany). To prepare 500 bp paired-end libraries of all isolates we used the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Bioengineering 2021Quote: ... DNA was extracted by using the QIAamp® DNA Stool kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol (Claassen et al. ...
-
bioRxiv - Microbiology 2021Quote: ... fecal or cultured bacterial DNA was isolated using QIAamp Fast DNA Stool Mini Kit (Qiagen) following the kit protocol ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was isolated using the MagAttract PowerMicrobiome DNA/RNA kit (Qiagen, Germantown, MD, USA) on the epMotion ® 5075 liquid handler (Eppendorf ...
-
bioRxiv - Molecular Biology 2022Quote: DNA was extracted from buffy coat and BAL using the QIAamp DNA Mini Kit (Qiagen). Single-genome amplification of a subgenomic HIV region (nef ...
-
bioRxiv - Immunology 2022Quote: DNA was extracted from KO cells using the QIAamp® DNA Mini Kit (#51304, Qiagen), followed by a genomic PCR with Q5® High-Fidelity DNA Polymerase (#M0491S ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA for anemones from each location was isolated with the AllPrep DNA/RNA kit (Qiagen) using the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: Genomic DNA of mESCs was extracted by using a QIAamp DNA mini kit (QIAGEN, 51306). For hACE2 mESCs ...
-
bioRxiv - Molecular Biology 2019Quote: ... and DNA extracted using a Qiagen EZ-1 instrument using the DNA Investigator kit (Qiagen). Swab heads were processed according to Qiagen protocols ...
-
bioRxiv - Microbiology 2019Quote: Genomic DNA from FFUP_PS_41 was extracted using a QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: DNA was extracted from fecal samples using Qiagen QIAamp DNA Stool Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: DNA extraction kit was used for bacteria DNA extraction (QIAGEN DNAeasy Kit (Qiagen; Hilden, Germany). An aliquot (1 μL ...
-
bioRxiv - Microbiology 2019Quote: DNA extraction kit was used for bacteria DNA extraction (QIAGEN DNAeasy Kit (Qiagen; Hilden, Germany). An aliquot (1 μL ...
-
bioRxiv - Cancer Biology 2019Quote: The DNA was extracted from the 18 samples using the QIAamp DNA Mini kit (QIAGEN), and whole-exome sequencing was carried out at 60X with the Ion Torrent PGM platform at the Fundación Pública Galega de Medicina Xenómica (FPGMX ...
-
bioRxiv - Genetics 2019Quote: ... DNA was isolated from 0.45 μm cellulose filters using DNeasy DNA Blood & Tissue kit (Qiagen), and from the 2.0 μm glassfiber filters using NucleoSpin Plant II Midi kit (Macherey-Nagel ...
-
bioRxiv - Genomics 2019Quote: ... Genomic DNA was extracted and purified using the QI Amp DNA Blood Mini kit (QIAGEN).
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted directly from stool using Qiagen QIAamp DNA Stool Extraction Kit (Qiagen, UK) and gadA PCR was performed as previously reported [16] (Table S1) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The genomic DNA was isolated using the QIAamp DNA Mini Kit (Qiagen, Cat. No. 51306) and DNA concentrations were measured on the Epoch microplate spectrophotometer (BioTek) ...
-
bioRxiv - Cancer Biology 2019Quote: DNA extraction from organoid cultures was carried out using a QIAamp DNA Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: Lung genomic DNA was extracted from frozen lungs using the QIAmp DNA mini kit (Qiagen) for qPCR analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNA was extracted alongside the RNA with the AllPrep DNA/RNA mini kit (Qiagen). Genomic DNA samples were processed further at the Barts and the London Genome Centre and run on Infinium MethylationEPIC arrays (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA was extracted 72 hours post-transfection with the QIAamp DNA Mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA was extracted 72 hours post-transfection with the QIAamp DNA Mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA was extracted 72 hours post-transfection with the QIAamp DNA Mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: DNA isolation was performed according to a modified QIAamp Fast DNA Stool Mini Kit (Qiagen) protocol that included a bead beating step with MoBio garnet beads ...
-
bioRxiv - Genomics 2019Quote: ... and genomic DNA and total RNA was extracted using AllPrep DNA/RNA mini kit (Qiagen). mRNA was purified from the total RNA using Oligotex mRNA mini kit (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... DNA was isolated from flash frozen cell pellets using the QIAamp DNA Micro kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2019Quote: The genomic DNA of gut microbiota was extracted with QIAamp DNA Mini Kit (51304, QIAGEN) from cecum contents or feces for subsequent 16S rRNA gene sequencing or metagenomics ...
-
bioRxiv - Genomics 2020Quote: ... and DNA was extracted from each sample using QIAamp DNA Blood Mini Kits (Qiagen 51104).
-
bioRxiv - Immunology 2019Quote: Microbial genomic DNA was extracted from whole fecal pellets using PowerFecal DNA Isolation Kit (QIAGEN); buffer-only controls were included in each extraction batch ...
-
bioRxiv - Microbiology 2019Quote: Chromosomal DNA was extracted from cells using the PureGene genomic DNA extraction kit (QIAGEN, GER). qPCR reactions were performed in a final volume of 10 μl containing ...
-
bioRxiv - Biophysics 2019Quote: ... DNA was isolated from a frozen cell pellet using the QiaAMP DNA Mini Kit (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: DNA was extracted using the Qiagen AllPrep DNA/RNA Mini Kit (Qiagen Ltd, Manchester, UK) and genotyped for rs6600247 using TaqMan SNP assay (custom order by Life Technologies ...
-
bioRxiv - Genomics 2021Quote: ... Genomic DNA was prepared from PBMCs or whole blood using QiaAmp DNA Blood kit (Qiagen), or phenol/chloroform extraction.
-
bioRxiv - Genomics 2021Quote: Genomic DNA was extracted from the samples using the AllPrep DNA/RNA MiniKit (Qiagen, 80204) following the user manual guidelines ...
-
bioRxiv - Genomics 2021Quote: ... DNA samples were extracted from blood specimens by the QIAamp DNA Blood Mini Kit (QIAGEN). Concentration and purity were checked through the Qubit fluorometer and the Nanodrop spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from treated sediments by using the PowerSoil DNA isolation kit (Qiagen, Germany). The 16S amplicon libraries targeting the V3-V4 regions of 16S rRNA genes [48] were prepared according to the Illumina 16S metagenomic sequencing library preparation guide by using a gel purification approach as described previously [23] ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Genomic DNA in FFPE sections was extracted using the AllPrep DNA/RNA FFPE Kit (Qiagen). Genomic DNA in frozen lung tissues from two P ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was extracted alongside the genomic DNA with the AllPrep DNA/RNA mini kit (Qiagen). RNA samples were DNase treated (Thermo Scientific ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA of homogenised soil was extracted using PowerSoil DNA extraction kits (Qiagen, Hilden, Germany). Approximately 0.25 g of soil was extracted from each sample with minor modifications to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were harvested and DNA purified using the Blood and Tissue DNA kit (Qiagen, MD). A 241 base pair amplicon spanning the AAVS1 target site was amplified in 25 cycles using NEB One Taq (AAVS1 −80bp Forward 5’ GACCACCTTATATTCCCAGG ...
-
bioRxiv - Evolutionary Biology 2021Quote: Enrichments were concentrated and genomic DNA was extracted using a QIAamp DNA Mini Kit (Qiagen). qPCR analysis was performed according to temperature conditions as previously described (Grant et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was isolated from cultured fibroblast or blood with QIAmp DNA Mini kit (QIAGEN). The mutations in the two Coriell fibroblast lines — BBS10A ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted from whole blood using either MagAttract HMW DNA Kit (QIAGEN, Germany) or NucleoSpin Blood Kit (Macherey-Nagel ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted from fresh frozen tissue using the QIAmp DNA mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... DNA was extracted using the Qiagen MagAttract plant DNA extraction kit (Qiagen, Valencia, CA, USA). CLas presence was detected by qPCR using the USDA-APHIS-PPQ protocol (38) ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA was isolated with a Qiagen genomic DNA 100/G kit (Qiagen, Hilden, Germany) with modifications to the ‘Part I sample preparation and lysis protocol for yeast’ of the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from cells using the QIAmp DNA Mini Kit (Qiagen ref. 51306) or ...
-
bioRxiv - Microbiology 2020Quote: DNA was extracted from thawed samples using the QIAamp PowerFecal DNA Kit (QIAGEN, Hilden, Germany), and quantified by the Qubit® dsDNA HS Assay using a Qubit® 2.0 Fluorometer (Invitrogen ...