Labshake search
Citations for Qiagen :
1151 - 1200 of 10000+ citations for Tonsoku Like DNA Repair Protein TONSL Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 1mg of bacterial genomic DNA (isolated from E. coli cells using genomic DNA kit, Qiagen), or tRNA (from E ...
-
bioRxiv - Cancer Biology 2023Quote: ... Genomic DNA (gDNA) from cultured cells was isolated using the QIAmp DNA Mini Kit (Qiagen), according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was extracted from stool using the QIAamp Fast DNA Stool Mini Kit (Qiagen 51604) and quantitative PCR was performed as described in the qPCR methods section using primer Ba04230899_s1 ...
-
bioRxiv - Microbiology 2023Quote: ... Fecal DNA was isolated using the QIAamp Fast DNA Stool Mini Kit (Qiagen, cat.51604), and sequencing was performed using the Illumina NovaSeq-6000 platform ...
-
bioRxiv - Developmental Biology 2023Quote: Genomic DNA was extracted from the polyps using the QIAamp DNA Micro Kit (QIAGEN, Germany). PCR amplification of ribosomal DNA (28S ...
-
bioRxiv - Cancer Biology 2023Quote: ... Genomic DNA from sorted cell populations was extracted using a QIAamp DNA Micro Kit (Qiagen).
-
bioRxiv - Cancer Biology 2023Quote: ... The genomic DNA was isolated from these tissues using QIA amp DNA Mini Kit (Qiagen) based on the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and genomic DNA and total RNA were extracted using a DNA/RNA mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from each isolate using a QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) for Illumina sequencing ...
-
bioRxiv - Immunology 2023Quote: ... DNA was isolated for each fraction using EZ1&2 DNA Blood 350µL kits (Qiagen, Hilden) and the EZ1 Advanced XL automated system (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA was prepared from cartilage specimens using QIAamp DNA Blood Mini Kit (QIAGEN, Germany) according to the manufacturer’s instructions and was stored at −80 °C until used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: DNA extraction was performed using the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen, Cat. #80224). Additional details about the animal exposures ...
-
bioRxiv - Microbiology 2023Quote: Bacterial DNA was extracted from fecal samples using the QIAamp Powerfecal DNA kit (Qiagen, Germany), and its concentration was quantified by Qubit® (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... DNA and RNA of sorted cells were extracted using AllPrep DNA/RNA micro kit (QIAGEN) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted using a combination of the QIAamp Fast DNA Stool Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: DNA extraction on cell lines was performed using the QiaAmp DNA Blood Mini kit (Qiagen). Reference DNA for the analysis was derived from multiple healthy and anonymous male donors (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA of each population was extracted using Qiagen DNA Blood Midi kit (Qiagen, 51183). The sgRNAs were amplified and prepared for sequencing with a previously described nested PCR protocol with slight modification to make sgRNA sequencing library compatible with Illumina read 1 primer ...
-
bioRxiv - Evolutionary Biology 2023Quote: Genomic DNAs were extracted using the Qiagen Blood & Cell Culture DNA Maxi Kit (Qiagen, Germany). Firstly ...
-
bioRxiv - Microbiology 2023Quote: DNAs from pure bacterial cultures were extracted using the QIAamp DNA mini kit (Qiagen, Germany). Following that ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from the bacterial suspension using the QIAamp BiOstic Bacteremia DNA Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we extracted DNA from the blood samples using a QIAamp BiOstic Bacteremia DNA Kit (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: Genomic DNA was extracted from tail tip-derived fibroblasts with a QIAamp DNA kit (Qiagen), treated with bisulfite using the EZ DNA Methylation-Direct kit (Zymo Research ...
-
bioRxiv - Genomics 2024Quote: DNA of acesulfame-grown cells was extracted with MagAttract HMW DNA Kit (QIAGEN, Hilden, Germany), according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was collected and purified from infected transwells using the QIAamp DNA Mini kit (Qiagen). Briefly ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA was extracted from wet-preserved museum specimens using the QIAamp DNA Micro Kit (QIAGEN) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... The genomic DNA was extracted using the QIAamp DNA Stool Mini Kit (Qiagen, Valencia, CA) modified to include bead-beating and RNase A treatment ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from stationary phase culture using DNeasy® DNA extraction kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Tumor and matched organoid DNA was isolated using with the QIAmp DNA Mini-Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2023Quote: ... Genomic DNA extraction of different clones was carried out using QIAamp DNA Mini Kit (Qiagen). DNA concentration was measured using Nanodrop One spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: DNA was extracted from organs using QIAamp DNA FFPE Tissue Kit (Qiagen, cat no 56404) and from blood samples using DNeasy Blood and Tissue Kit (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... Genomic DNA was isolated from these cells using the AllPrep DNA/RNA Micro Kit (Qiagen). Digital droplet (dd)PCR assays were performed as previously described (Wray-Dutra et al. ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from fecal samples using QIAamp® PowerFecal® Pro DNA kits (Qiagen). Samples were thawed and approximately 250mg of fecal sample was lysed via bead beating ...
-
bioRxiv - Microbiology 2023Quote: ... Bacterial DNA was extracted using the QIAamp DNA mini kit and QIAgen Biorobot by QIAGEN. Whole-genome sequencing was conducted on Illumina Genome Analyzer II and HiSeq platforms ...
-
bioRxiv - Bioengineering 2024Quote: ... The microbiome total DNA was extracted using the QIAamp DNA Microbiome Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... total cell DNA was isolated using a QIAamp DNA Blood Minikit (QIAGEN, Hilden, Germany, #51106) and then the homozygous deletion was screened and the cells with homozygous KO were selected and confirmed by PCR ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was isolated from samples using the QIAamp DNA Blood Maxi Kit (Qiagen; 56404). DNA was fragmented using Ndel and SacII restriction enzymes (New England Biolabs ...
-
bioRxiv - Genetics 2024Quote: ... and genomic DNA was extracted using a QIAamp DNA Blood Mini Kit (QIAGEN, Germany; 51126). The exomes of the subjects were captured by Agilent SureSelect Human All Exon V6 Enrichment kits (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was then extracted using a single column of QIAamp DNA Blood Mini Kit (Qiagen), following the manufacturers protocol and adjusting initial reaction volume ...
-
bioRxiv - Systems Biology 2019Quote: ... To summarize the cellular locations and protein classes the protein list was annotated using Ingenuity Pathway Analysis (Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: ... Lysates were then processed for RNA and DNA extraction using AllPrep DNA/RNA Mini kit (Qiagen), with Complete Protease Inhibitor (Roche ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was isolated from strains using the QIAamp DNA mini kit from Qiagen (Hilden, Germany) according to their manufactures protocol ...
-
bioRxiv - Cell Biology 2019Quote: Genomic DNA was extracted from blood with the DNA QIAcube HT kit (Qiagen, Germantown, MD USA). PCR of the PLIN2 region of interest was performed using forward (5’AGGTTAGAGTCCAGGCCTTAT3’ ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... genomic DNA (gDNA) was isolated from herbarium samples using the BioSprint 15 DNA Plant Kit (Qiagen), or from fresh or silica gel dried leaves using the Plant DNeasy Extraction Kit (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: MEFs were collected by trypsinization and DNA was isolated using QIAamp DNA Mini kit (Qiagen, 51304), followed by ethanol precipitation and resuspension to 1 μg/μl in 10 mM Tris ...
-
bioRxiv - Genetics 2021Quote: ... we extracted DNA from the secondary substrates using the QIAamp DNA Investigator Kit (QIAGEN, Valencia, CA). The procedure from the QIAamp DNA Investigator Handbook for the Isolation of Total DNA from Body Fluid Stains was selected as it has a denim option to remove any inhibitors ...
-
bioRxiv - Microbiology 2022Quote: ... DNA isolation was performed in duplicate with a modified QIAamp Fast DNA Stool Mini Kit (Qiagen) protocol ...
-
bioRxiv - Genetics 2022Quote: ... Genomic DNA and total RNA extraction was performed using the QIAamp DNA Blood Mini kit (QIAGEN) and RNeasy Mini kit (QIAGEN) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and genomic DNA (gDNA) was isolated from surviving cells using a QIAmp DNA Mini Kit (QIAGEN) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was extracted from the digest with the QIAamp PowerFecal DNA Kit (Qiagen, Valencia, California, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... 100 μg/ml proteinase K) for DNA extraction using a QIAamp® DNA Mini Kit (Qiagen). DNA samples were used for bacterial profiling with high-throughput 16S rRNA amplicon sequencing and quantitative polymerase chain reactions.