Labshake search
Citations for Qiagen :
901 - 950 of 10000+ citations for Tonsoku Like DNA Repair Protein TONSL Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: DNA was isolated from the frozen samples using a QIAamp DNA Mini kit (QIAGEN) with RNAse treatment and from the FFPE sample with a turXTRAC FFPE DNA kit (Covaris) ...
-
bioRxiv - Immunology 2022Quote: DNA was extracted from stool samples using QIAmp Fast DNA Stool Mini Kit (Qiagen). 16S rRNA V3 and V4 regions were amplified by PCR using Kapa Hifi Hotstart Ready Mix (KAPA Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA and DNA were extracted using the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Mitochondrial DNA was extracted using QiAamp DNA mini kit following the manufacturer instructions’ (Qiagen). DNA was quantified using Sybr Select Master Mix (Applied Biosystems) ...
-
bioRxiv - Systems Biology 2022Quote: DNA was extracted using a blood and cell culture DNA mini kit (13323, Qiagen) from low passage cell lines ...
-
bioRxiv - Microbiology 2022Quote: ... and genomic DNA (gDNA) was extracted using the QIAamp DNA Blood Midi Kit (Qiagen). The concentration of gDNA was quantified using the Qubit dsDNA BR assay kit and measured with a Qubit 2.0 fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was isolated using the Blood and Cell Culture DNA Maxi Kit (Qiagen) and integrated gRNA sequences were amplified by PCR using HiFi HotStart ReadyMix (KAPA) ...
-
bioRxiv - Microbiology 2022Quote: ... Total DNA was extracted using the DNeasy PowerWater DNA extraction kit (Qiagen, The Netherlands) following the manufacturers’ instructions ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted using the QIAamp Fast DNA stool mini kit (QIAGEN, Hilden, Germany) automated on the QIAcube (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from fecal pellets using the QIAamp Powerfecal Pro DNA kit (QIAGEN) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: Microbial DNA was isolated with the QIAmp Fast DNA Stool Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and genomic DNA was extracted using the QIAmp DNA Mini Kit (QIAGEN, Crawley, UK), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA was purified using the QIAmp DNA Blood Maxi kit (QIAGEN, cat # 51194) and the integrated sgRNA sequences were amplified and barcoded by two-step PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... and DNA was extracted with the MagAttract PowerSoil Pro DNA kit (Qiagen, Hilden, Germany) using an Opentrons-2 (Opentrons Labworks ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA and genomic DNA were extracted using the AllPrep DNA/RNA Mini Kit (Qiagen). Library preparation for RNA sequencing was performed by the Yale Center for Genome Analysis (YCGA) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from fecal pellets using the QIAamp Powerfecal Pro DNA kit (QIAGEN) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... and genomic DNA was then extracted using the QIAamp DNA Blood Mini Kit (Qiagen). DNA concentrations were determined using the Qubit dsDNA BR assay kit (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... DNA was isolated from the amniotic fluid by using the QIAmp DNA minikit (Qiagen). We utilized a 45-cycle real-time qPCR reaction using 5′-GTTTAGGGAACCGCCATTCTG-3′ forward primer ...
-
bioRxiv - Immunology 2023Quote: ... genomic DNA and total RNA were extracted using a DNA/RNA mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Bacterial DNA was isolated using a Qiamp PowerFecal DNA Isolation Kit (Qiagen, Hilden, Germany). A negative control was inserted periodically in the workflow after blocks of 16 samples to test for methodological contamination during processing ...
-
bioRxiv - Microbiology 2023Quote: ... and genomic DNA (gDNA) was purified using the QIAamp DNA Blood Midi Kit (Qiagen). gDNA concentrations were quantified by Qubit using the dsDNA HS Assay (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from fecal pellets using the QiaAmp PowerFecal pro DNA kit (Qiagen). To confirm proper template integration for each transgenic strain ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was amplified with the REPLI-g Advanced DNA Single Cell Kit (Qiagen), and successful amplification of chytrid DNA was verified by PCR with the primers ITS4ngsF (5’-GCATATCAATAAGCGSAGGA-3’ ...
-
bioRxiv - Microbiology 2023Quote: Fecal and cecal DNA were extracted using the QIAamp DNA Stool Mini Kit (Qiagen) according to the manufacturer’s protocol with modifications ...
-
bioRxiv - Immunology 2023Quote: ... DNA was extracted using QIamp Fast DNA Stool Mini Kit following manufacturer’s instructions (Qiagen). RNA was extracted and purified using a RNeasy mini kit (Qiagen) ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was isolated using the QIAamp DNA blood mini kit (51106, Qiagen, Hilden, Germany) according to manufacturer’s protocol after a couple of days and CRISPR/Cas9 induced editing efficiency was analyzed by PCR and separation of amplicon on 2% agarose gel containing 1:10.000 GelRed nucleic acid gel stain (41003 ...
-
bioRxiv - Biochemistry 2023Quote: Genomic DNA was extracted from cell pellets using QiaAMP DNA Mini Kit (Qiagen, 51306). Barcodes were PCR amplified using 5’- GATATTGCTGAAGAGCTTG and 5’- CCAGAGGTTGATTGTTCCAGA ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA of mutant cells was isolated using DNA Blood Mini Kit (QIAGEN, 51106) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA from each clone was extracted using the QIAamp® DNA Mini Kit (Qiagen).
-
bioRxiv - Genomics 2023Quote: ... The eluted DNA was then further purified with the MagAttract HMW DNA kit (Qiagen) per the manufacturer’s whole blood purification protocol ...
-
bioRxiv - Genomics 2023Quote: ... DNA was then extracted from the lysate using the QIAamp DNA Mini Kit (Qiagen) with a modified protocol as follows ...
-
bioRxiv - Genomics 2023Quote: ... The eluted DNA was then further purified using the QIAamp DNA mini kit (Qiagen) by diluting the DNA to a final volume of 200 μL and final 1x PBS concentration ...
-
bioRxiv - Genetics 2023Quote: We extracted genomic DNA from scats using QIAamp DNA Mini Stool Kit (Qiagen, Germany) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by proteinase K digestion and DNA isolation with QIAmp DNA Mini Kit (Qiagen), following the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was extracted from the sampled specimens using the QIAamp DNA Micro kit (Qiagen). Given the fragility of these old samples ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was extracted from a single female using the QIAamp DNA Micro Kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: Bacterial DNA was extracted using QIAamp Fast-DNA Mini Kit (Qiagen, no: 51604, Germany) following the manufacturer’s recommended procedure ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA was prepared using Qiagen’s QIAamp DNA blood maxi kit (Qiagen Cat #51194) as recommended by the manufacturer ...
-
bioRxiv - Genomics 2023Quote: Bacterial genomic DNA was isolated using the UltraClean microbial DNA extraction kit (Qiagen, Germany) and sequenced with a PacBio RS II sequencer (Pacific Biosciences ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... The DNA of 307 samples was extracted with QIAamp DNA Stool Mini Kit (Qiagen) using TE (1 M Tris-Cl ...
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... Total RNA and DNA was isolated using AllPrep DNA/RNA Micro Kit (QIAGEN, 80284).
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... and RNA and DNA were isolated using the AllPrep DNA/RNA micro kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... DNA extraction was performed using Qiamp DNA Blood Mini Kit (Qiagen® Inc., USA), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Prior to DNA extraction from ulcerative lesion samples using the QIAamp DNA kit (Qiagen), sonication and DNAse/RNAse treatment was performed [8] ...
-
bioRxiv - Biochemistry 2023Quote: Genomic DNA was extracted from screen pellets using QIAamp DNA Blood Maxi Kit (QIAGEN) and gRNAs were isolated using PCR ...
-
bioRxiv - Bioengineering 2023Quote: ... the DNA of the cells was collected using QIAamp DNA Mini Kit (QIAGEN, #51304). The Q5 DNA polymerase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... the DNA was obtained using a Plant Pro DNA extraction kit (Qiagen, Germantown, MD) with no additions to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... DNA was extracted from donor liver tissues using the QIAamp DNA Mini Kit (Qiagen). For RNA extraction ...
-
bioRxiv - Evolutionary Biology 2024Quote: Genomic DNA was extracted from each individual using the Biosprint DNA Blood Kit (Qiagen) on a Thermo KingFisher Flex automated extraction instrument ...
-
bioRxiv - Microbiology 2024Quote: ... and DNA from cultures was extracted using the QiAmp DNA minikit (Qiagen, Germantown, MD) according to manufacturer instructions ...