Labshake search
Citations for Qiagen :
751 - 800 of 2131 citations for 5 Bromobenzothiazole 2 sulfonic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 5 PCRs were pooled and purified on one Qiaquick spin column (Qiagen) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... 5 ml of the culture was mixed with RNAprotect Bacteria Reagent (QIAGEN) at a 1:2 ratio ...
-
bioRxiv - Microbiology 2024Quote: ... (5) DNA was purified after reverse crosslinking using a MinElute column (Qiagen) as directed and quantified by a Qubit fluorometer (Invitrogen).
-
bioRxiv - Evolutionary Biology 2024Quote: ... trigynum homostyle=5 individuals) using the RNeasy Plant Mini Kit (QIAGEN, Germany). Libraries were sequenced on an Illumina NovaSeq S1 Sequencing System to produce paired-end 150bp read length reads ...
-
bioRxiv - Cell Biology 2024Quote: ... or p300 (Qiagen, Sequence: 5′-TAG TCT GGT CCT TCG T-3′) for 24hr ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL (50U) of high-concentration klenow 3’-5’ exo-polymerase (Qiagen) was added ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA from MCF7 cells was isolated by proteinase K digestion at 65°C for 30 minutes followed by purification using the QIAamp circulating nucleic acid kit (Qiagen, Venlo, The Netherlands). Genomic DNA from frozen tissue sections of colorectal liver metastases was isolated using the NucleoSpin Tissue kit according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was then purified using a nucleic acid binding column with on-column DNase treatment (RNase-free DNase set, QIAGEN, Germantown, MD, USA). RNA was then eluted from the column in elution buffer.
-
bioRxiv - Genomics 2022Quote: ... Nucleic acids were extracted at CNM using either QIAamp MinElute Virus Spin (DNA) or QIAamp Viral RNA Mini kits (Qiagen, Germantown, MD, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: Pathway analysis was performed to integrate the targeted amino acid results using the Ingenuity Pathway Analysis Software (IPA) version 70750971 (QIAGEN, Redwood City, USA). Metabolites strongly correlated with tumor weight were identified using Spearman’s rank correlation analysis ...
-
bioRxiv - Bioengineering 2024Quote: ... The clarified supernatant was loaded onto a pre-equilibrated gravity flow column of nickel-nitrilotriacetic acid (Ni-NTA) beads (Qiagen, Germantown, MD, USA). The column was washed with the increasing concentration of imidazole and the recombinant nanobody protein was eluted at a gradient of 250-500 mM imidazole concentration in elution buffer (50 mM Sodium Phosphate ...
-
bioRxiv - Biophysics 2024Quote: ... for 30 min at 4 °C before being applied to a 10mL bed volume Nickel nitrilotriacetic acid (Ni-NTA) agarose (Qiagen, cat. no. 30230) column ...
-
bioRxiv - Microbiology 2024Quote: ... 140µl of the sample suspension was used to extract total viral nucleic acid using the QIACube QIAamp viral RNA mini kit (Qiagen, Valencia, CA, USA) using the QIACube extraction instrument (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... root or shoot tissues were ground in 2 mL tubes (Qiagen) containing 3 chrome steel beads of 3.2 mm diameter (BioSpec Products ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 hours and purified using QIAquick PCR Purification Kit (Qiagen). Guide RNA sequence was ordered as oligos (Tm = 51°C ...
-
bioRxiv - Microbiology 2024Quote: ... cells were treated with 2× volume of RNAprotect Bacteria Reagent (QIAGEN) for 10 min at room temperature and collected as pellets by centrifugating for 10 min at 5,000×g ...
-
bioRxiv - Genomics 2024Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Genomics 2024Quote: ... 2 ml of RNAprotect® Bacteria Reagent (cat # 76506, Qiagen Inc.) was added ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Microbiology 2021Quote: ... was modified by a custom-added biotin residue at its 5’-end (Qiagen). Hybrids of the CoV-2 RNAs with the probe were detected with a goat anti-biotin antibody conjugated to 10 nm gold particles (BBI international).
-
bioRxiv - Cell Biology 2020Quote: ... mRNA samples were concentrated to ≤ 5 µl by MinElute column (QIAGEN, Cat. 74204). For generation of RNA-seq libraries ...
-
bioRxiv - Immunology 2021Quote: RNA was isolated from ~5 x 105 cells using RNeasy mini kits (Qiagen), typically yielding 100-400 ng RNA ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples were homogenized using 5 mm steel beads and a Tissuelyser II (Qiagen) operated at 30 Hz for 5 min ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...
-
bioRxiv - Immunology 2020Quote: ... 5 U/ml dispase (Stemcell) and 50 mg/ml DNase I mix (Qiagen) in complete RPMI1640 medium ...
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNA was isolated from 5 million cells using the DNAeasy kit (Qiagen). 4ug gDNA was digested with NlaIII or MseI ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 μl of 10% SDS and 5 ul of Proteinase K (Qiagen #19131) were added to each sample ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 10x CoralLoad PCR buffer and 5 µl of TopTaq Master Mix 2x (Qiagen). An initial denaturation cycle of 94°C for 6 min was followed by 35 cycles of 94°C for 45 s ...
-
bioRxiv - Biochemistry 2022Quote: ... The cleared lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen) and the column was washed in two steps with lysis buffer supplemented with 25 and 50 mM imidazole ...
-
bioRxiv - Physiology 2022Quote: ... mRNA samples were concentrated to ≤ 5 µl by MinElute column (QIAGEN, Cat. 74204). For generation of RNA-seq libraries ...
-
bioRxiv - Microbiology 2022Quote: ... The cleared lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen). The column was washed with 3 column volumes of lysis buffer and proteins were eluted stepwise with lysis buffer supplemented with 50 and 250 mM of imidazole ...
-
bioRxiv - Microbiology 2022Quote: ... The cleavage products were passed through a 5 mL Ni-NTA cartridge (Qiagen) and the column was washed with 5 column volumes of lysis buffer supplemented with 50 mM imidazole to remove the cleaved tag and the TEV protease ...