Labshake search
Citations for Qiagen :
51 - 100 of 1462 citations for tert Butyl trans 17 bromo 4 7 10 13 tetraoxa 15 heptadecenoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... All were designed using CLC Genomics Workbench 7 (Qiagen) and synthesized by Eurofins Genomics (http://www.eurofins.com) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 7 µL of PolyFect transfection reagent (QIAGEN, Duesseldorf, Germany) was added ...
-
bioRxiv - Genomics 2022Quote: ... as described previously.(17) The amplified library was purified using a PCR Cleanup Kit (Qiagen #28104) and size selected for 150-500–bp fragments on a 2% agarose gel ...
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0) containing 15 mg/mL of lysozyme + 15 µL of proteinase K solution (20 mg/mL, Qiagen), and then incubated for 8–10 min ...
-
bioRxiv - Microbiology 2023Quote: ... DNA extractions were carried out using the Biosprint 15 DNA Plant Kit and Biosprint 15 robot (Qiagen, Australia) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... 15 µl of Pyrosequencing Annealing Buffer (Qiagen) were mixed with 15 µl of each sample and overhangs were quantified by Pyrosequencing using the following dispensation order GTGTGTCACACATGTGTGTG (nucleotides were pipetted in a two-fold dilution ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 15 min of DNase I (Qiagen) treatment.
-
bioRxiv - Evolutionary Biology 2023Quote: ... each of 15 μL of EB (Qiagen) buffer incubated at 37 C for 10 minutes.
-
bioRxiv - Cancer Biology 2023Quote: ... 4 sections 10 µm thick were placed in a chilled Eppendorf tube and RNA extraction protocol from Qiagen was performed (Rneasy FFPE Kit 73504 ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 minutes 4°C and the supernatant was incubated with pre-equilibrated Ni-NTA agarose beads (Qiagen, #1018244) with shaking on ice for 3 hours ...
-
Coloring inside the lines: genomic architecture and evolution of a widespread color pattern in frogsbioRxiv - Evolutionary Biology 2021Quote: ... RNA was extracted from the skin of 13 individuals using a RNeasy mini kit (Qiagen, Valencia, CA). For eight individuals ...
-
bioRxiv - Developmental Biology 2020Quote: ... The significantly changed proteins were used as inputs for Ingenuity Pathway Analysis (IPA, Version 03-13, Qiagen). The IPA predicted the altered pathways ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from 13 ml of the culture using a DNeasy Blood & Tissue kit (Qiagen) according to the manufacturer’s instructions for Gram-negative bacteria ...
-
bioRxiv - Molecular Biology 2023Quote: ... organs from adult mice (9-13 weeks old) were harvested and homogenized in Qiazol lysis reagent (Qiagen) and total RNA was isolated by phenol–chloroform extraction according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... organs from adult mice (9-13 weeks old) were harvested and homogenized in Qiazol lysis reagent (Qiagen) and total RNA was isolated by phenol–chloroform extraction according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: DNA was extracted from 13 mg of muscle tissue using a DNeasy Blood and Tissue kit (Qiagen), quantified using Qubit dsDNA HS Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... A selection of four candidate markers were tested for polymorphism and sex-linkage using 15 adult males and 15 adult females in two Multiplex PCR Kit reactions (Qiagen; see Supplemental Table 1 for primer sequences and Supplemental Table 2 for PCR conditions) ...
-
bioRxiv - Neuroscience 2021Quote: Total RNAs were extracted from 20 heads (or 15 thoraces or 15 abdomens) of 8-day-old flies using the QIAzol Lysis reagent (Qiagen). The Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: Genomic DNA was extracted from frozen ground young leaf using the BioSprint 15 Plant Kit on the BioSprint 15 Workstation (Qiagen, Crawley ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was collected 7 days post-TGFB1 treatment (RNAeasy Kit, Qiagen). cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... IDT) in a tube containing 7 μL Vapor-Lock (Qiagen, 981611) to prevent evaporation ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmids were transfected in COS-7 cells with Effectene (Qiagen, Germany) according to the manufacturer’s protocols for 22 hours ...
-
bioRxiv - Genomics 2023Quote: ... The 600 cell pellets (1e+7) were prepared with RNAprotect (Qiagen) and stored at -80°C until shipment on dry ice ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15 µl Hi-PerFect Transfection Reagent (Qiagen; #301705) and 60 µl of siRNA mixture (1 µM ...
-
bioRxiv - Developmental Biology 2023Quote: ... and eluted in 15 μl Buffer EB (QIAGEN). 1 ng of pre-amplified cDNA was used for the tagmentation reaction (55C ...
-
bioRxiv - Cell Biology 2021Quote: Tissue lysates were further homogenized and centrifuged at 10,000 g for 10 min at 4°C in microcentrifuge spin columns (QIAshredder, Qiagen) to obtain clear protein lysate ...
-
bioRxiv - Molecular Biology 2022Quote: His-Prs or its variants (10 µg) were bound to 4 µl of Ni-NTA Magnetic Agarose Beads (Qiagen) in 50 µl interaction buffer (50 mM Tris pH 9.0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... approximately half of the infected tissue was cut into small pieces and DNA was extracted using a BioSprint 15 instrument and BioSprint 15 DNA plant kit (Qiagen, Australia) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR analysis was performed using 15 ng of cDNA to a final volume of 15 μL reaction with Rotor-Gene SYBR® Green PCR Kit (Qiagen), in a Rotor Gene-Q (R ...
-
bioRxiv - Developmental Biology 2022Quote: ... we treated rat AFSCs at 60% confluence with miR-17-5p and - 20a power inhibitors (25 μM) following the manufacturer’s protocol (Qiagen YI04100215-DDA ...
-
bioRxiv - Cell Biology 2023Quote: ... Complexes were pulled down using Glutathione-Sepharose 4B resin (Cytiva; 17-0756-01) or Ni-NTA resin (QIAGEN; 30210) for 2 h at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells attached to the collagen matrix were fixed with 4% PFA for 10 minutes at room temperature for IF analysis or lysed with RLT buffer (Qiagen) for RNA isolation and qRT-PCR analysis as described above.
-
bioRxiv - Plant Biology 2021Quote: ... We extracted total RNA from 10 leaves that were shorter than 500 µm and from 4–6 mature leaves using the RNeasy Micro Kit (Qiagen) and the RNeasy Plant Mini Kit (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... 80 µL of the mixture was then incubated for 45-60 minutes at room temperature or 4°C with 10 µL NiNTA resin (Qiagen) prewashed with His-SUMO Lysis buffer (20 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Neuroscience 2023Quote: ... freshly sorted cells were pelleted at 500 g for 10 minutes at 4° and then resuspended in RLT Plus buffer (Qiagen). Cells were vortexed and frozen for at least one day at −80° before being thawed on ice and processed for RNA using an RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... The remaining cells were pelleted at 1000 x g for 10 minutes at 4°C and lysed in 350 µL of Buffer RLT (Qiagen) supplemented with 3.5 µL of 2-β mercaptoethanol (#444203 ...
-
bioRxiv - Biochemistry 2024Quote: ... Total RNA was extracted from the supernatant (12,000 x g for 10 min at 4°C) of centrifuged tissue homogenate using an RNeasy Mini Kit (Qiagen, USA). The extracted total RNA was used for single-strand cDNA synthesis ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then samples and inputs were incubated for 4 hr at 37°C with 1.5 µl of 10 mg/ml RNase A (Qiagen, 1007885) and 15 µl 10% sodium dodecyl sulfate and 3.5 µl 20 mg/ml Proteinase K (Thermo Fisher ...
-
bioRxiv - Genomics 2024Quote: Ten aphids (n = 10 × 4) were ground to powder with a liquid nitrogen-cooled micropestle after which the RNeasy kit (Qiagen) was used for RNA extraction with on-column DNA digestion (Qiagen) ...
-
bioRxiv - Cell Biology 2024Quote: ... and RNA was isolated at day 7 using RNeasy Micro Kit (Qiagen). For each experiment untreated vehicle controls were applied ...
-
bioRxiv - Bioengineering 2022Quote: Decellularization for porcine AECMs met the stringent criteria for decellularized ECM.15 Residual dsDNA content was quantified from 15 mg of powdered ECM using the QIAamp DNA Mini Kit (QIAgen, Germantown, MD) followed by Qubit 2.0 (ThermoFisher Scientific ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The samples were centrifuged and the supernatant mixed with 13 mL of a modified PB buffer (12.6 mL PB buffer (Qiagen), 6.5 μL Tween-20 ...
-
bioRxiv - Genomics 2023Quote: Total genomic DNA was extracted from 13 faecal samples using the Qiagen QIAamp Mini Stool Kit (Qiagen, Hilden, Germany) as per the manufacture’s protocol with some modifications ...
-
bioRxiv - Microbiology 2020Quote: ... that included a 15 min DNAse treatment (Qiagen, 79254) treatment at RT ...
-
bioRxiv - Immunology 2020Quote: ... with a 15-minute on-column DNase digestion (Qiagen) to remove genomic DNA ...
-
bioRxiv - Immunology 2020Quote: ... and 15% Glycerol from the JCSG Core II (Qiagen) screen ...
-
bioRxiv - Immunology 2021Quote: ... DNAse treatment (15 min at RT; Qiagen, Hilden, Germany) was only conducted in samples used for RNASeq but not in samples used for qPCR analysis ...
-
bioRxiv - Microbiology 2023Quote: ... EasyXtal 15-well Tool crystal plates (Qiagen, Manchester, UK) were set up manually for HAdV-D15 ...