Labshake search
Citations for Qiagen :
851 - 900 of 2036 citations for Polystyrene Latex Beads 5 um since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... in 5-ml polypropylene columns (no. 34964; Qiagen), washed with 50 mM Na2HCO3 ...
-
bioRxiv - Microbiology 2021Quote: ... in a 5 ml tube (Qiagen, DNAse/RNAsefree). The sediment samples were kept at 4 °C until the next day and then stored at −80 °C ...
-
bioRxiv - Immunology 2020Quote: ... 5×106 PBMCs were resuspended in RLT (Qiagen) and incubated at room temperature for 10 min prior to storage at –80°C ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of 2U/μL Turbo DNase (Qiagen), and 1 μL of 10 mg/mL RNase A (Qiagen) ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM primers and 1 μl DNA template ...
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM Primer and 1 μl DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl Polyfect Transfection Reagent (Qiagen, catalog # 301105) was added ...
-
A conserved RNA switch for acetylcholine receptor clustering at neuromuscular junctions in chordatesbioRxiv - Developmental Biology 2024Quote: ... 5 U/μL HotStarTaq Plus DNA polymerase (Qiagen) (0.4 μL ...
-
bioRxiv - Molecular Biology 2024Quote: QIAcuity Probe 5 mL PCR Kit (Qiagen, 250102)
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Genetics 2020Quote: ... Beads were then washed with RIPA buffer and treated with RNaseA and proteinase K (Qiagen). DNA was eluted from the beads in Tris-EDTA buffer and cleaned up using the Nucleospin Gel and PCR Purification kit (Macherey-Nagel) ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by 2 minutes (40 oscillation per second) on a bead shaker (Qiagen Tissue lyser)-centrifuged at 1000g for 5 minutes at 4 °C to remove debris ...
-
bioRxiv - Genomics 2020Quote: ... The supernatant of cell lysate was incubated with 1 mL Ni-NTA agarose beads (QIAGEN) at 4 °C for 1 h ...
-
bioRxiv - Genetics 2020Quote: ... Liver samples were homogenised with the Qiagen Bead Tissue Lyser (Qiagen Manchester Ltd, Manchester, UK) in 500μL of 50mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Biochemistry 2020Quote: ... Amylose elution pool was bound to Nickel NTA (NiNTA) affinity beads (Qiagen, Germantown MD, USA), washed with NiWB (500 mM Sodium Chloride ...
-
bioRxiv - Bioengineering 2021Quote: ... the obtained soluble extract was mixed with 2 ml slurry Ni-NTA beads (30210, QIAGEN), incubated at 4 °C for 2 h with rotation.
-
bioRxiv - Biochemistry 2021Quote: ... the obtained soluble extract was mixed with 2 ml slurry Ni-NTA beads (30210, QIAGEN), incubated at 4°C for 2 h with rotation ...
-
bioRxiv - Systems Biology 2020Quote: ... with 3 mm beads then extracted according to the protocol using RNeasy Mini Kit (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... PCR products were eluted from the magnetic beads with 32 μl of Buffer EB (Qiagen) and 30 μl of the eluate were transferred to a fresh 96-well plate ...
-
bioRxiv - Microbiology 2020Quote: ... Cell debris were eliminated by centrifugation and 1 mL of Ni-NTA superflow beads (Qiagen) was added to bind his-tagged proteins ...
-
AMPK is elevated in human cachectic muscle and prevents cancer-induced metabolic dysfunction in micebioRxiv - Molecular Biology 2022Quote: ... the muscles were homogenized (2 × 30 sec, 30 Hz, TissueLyser II bead mill, Qiagen, USA) in a modified GSK3-buffer (10% glycerol ...
-
bioRxiv - Cell Biology 2022Quote: ... The mRNA binding to beads was eluted and purified with RNeasy MinElute Spin columns (Qiagen), followed by cDNA synthesis ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was clarified by centrifugation and bound to Ni-NTA agarose beads (QIAGEN #30230) for 45 min at 4ºC ...
-
bioRxiv - Molecular Biology 2022Quote: The supernatant was mixed with 1 ml resin volume of Ni-NTA beads (Qiagen, 30210) which was pre-equilibrated with Lysis buffer supplemented with 40 mM imidazole and 0.1 mM ATP ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 48k rcf and bound to Ni-NTA agarose beads (Qiagen). The beads were washed with the resuspension buffer and eluted with 20 mM Tris HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... The harvested cells were sonicated under ice and purified by Ni-NTA agarose beads (Qiagen) in lysis buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cell Biology 2021Quote: ... Beads were removed and DNA was isolated using PCR purification kit (Qiagen, Cat. No. 28104).
-
bioRxiv - Neuroscience 2020Quote: ... Tissues were homogenized using stainless steel beads in a TissueLyser II apparatus (Qiagen, Hilden, Germany). Placental RNA was purified using the RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... BapR-CPD-His was affinity purified from cleared lysates using Ni-NTA agarose beads (Qiagen) with gentle rocking at 4°C for 2 hours ...
-
bioRxiv - Microbiology 2021Quote: Collected lung tissues were homogenized using bead disruption (Precellys) in 350μL RLT buffer (RNeasyMinikit, Qiagen)and centrifuged (10.000 rpm ...
-
bioRxiv - Synthetic Biology 2021Quote: Fecal pellets were homogenized in PBS with an autoclaved single 5mm stainless steel bead (Qiagen) using TissueLyser II (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cleared lysates were mixed with 0.5 ml Ni-NTA beads (250 μl bed volume, Qiagen), pre-washed with two times 5 ml lysis buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... The resulting supernatants were recovered and incubated with 0.5 ml Ni-NTA beads (Qiagen, 30230), previously equilibrated in His-lysis buffer ...
-
bioRxiv - Genomics 2020Quote: ... 20μL of beads were magnetically separated and washed once with 900μL RLT Buffer (79216, Qiagen), resuspended in 300μL RLT Buffer ...
-
bioRxiv - Genomics 2020Quote: ... Beads were dried at room temperature for 1 minute and 50uL of EB buffer (Qiagen) was added slowly on top of the beads ...
-
bioRxiv - Microbiology 2020Quote: ... The histidine-tagged proteins MprA and MprA* were purified using Ni-NTA Agarose beads (Qiagen) using standardized protocol(Chadha et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... samples are homogenized in the provided bead tubes using a TissueLyser II (Qiagen, Venlo, Netherlands) for three minutes at 30/sec ...
-
bioRxiv - Immunology 2022Quote: ... The initial homogenization was performed mechanically (2 metal beads/sample) using a TissueLyserLT (#85600, Qiagen) homogenizer (50 oscillations/s for 10 min) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was isolated by disrupting tissue in RNA STAT-60 using 5mM steel beads (Qiagen) and a TissueLyser II (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... Organs from each animal were harvested and homogenized in sterile PBS using steel beads (Qiagen) and a bead beater ...
-
bioRxiv - Immunology 2022Quote: ... tissues were disrupted using lysis beads and a homogenizer unit (Precellys) in RLT buffer (Qiagen). RNA was isolated using RNEasy Mini or Micro kits (Qiagen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tumor nodules were micro-dissected and homogenized using a 5mm stainless steel bead (Qiagen, #69989) and a Tissue LyserII (Qiagen ...