Labshake search
Citations for Qiagen :
701 - 750 of 2036 citations for Polystyrene Latex Beads 5 um since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Ophthalmic acid is a bloodborne metabolite that contributes to age-induced cardiomyocyte hypertrophybioRxiv - Physiology 2024Quote: ... Tissues were homogenized with Qiagen stainless steel beads (Qiagen, Hilden, Germany, Lot #2271122) using the Qiagen TissueLyser II system (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: ... cell samples or coIP beads with the RNAeasy Mini Kit (#74104, Qiagen, Germany) including an on-column DNAse digestion (#79254 ...
-
bioRxiv - Immunology 2024Quote: ... The supernatant was incubated with 1 ml of Ni-NTA agarose beads (Qiagen) pre-equilibrated in resuspension buffer for 1 hour at 4 °C with gentle rotation ...
-
bioRxiv - Biochemistry 2024Quote: ... The soluble fraction was then added to 4 mL Ni-NTA beads (Qiagen) pre-washed in water ...
-
bioRxiv - Cell Biology 2024Quote: ... His6-tagged ubiquitinated proteins were isolated on Ni2+-NTA agarose beads (Qiagen #30210) for 4 hours at RT ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... transferred to 2.0 mL ceramic bead mill tubes (Qiagen Catalog Number 13116-50) and centrifuged at maximum speed ...
-
bioRxiv - Biochemistry 2024Quote: ... supernatants were applied to a column packed with Ni-NTA agarose beads (Qiagen) pre-equilibrated in buffer A ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... an aliquot (5 µL) was treated with 0.5 µL of 5 mg/ml RNase A (QIAGEN, Hilden, Germany) at 37 °C for 30 min ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Bioengineering 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 μL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Genetics 2023Quote: ... 5 ul of 5X Q-solution (Qiagen), 1 ul of 5 mM 7-deaza-dGTP (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAse A (5 μg/mL, Qiagen #19101) was added to the whole cell extracts (WCE ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.7 × 10−5 AU/mL protease (Qiagen), 1.0 μM barcoded oligodT-ISPCR primer ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 µL Multiplex PCR Master Mix (QIAGEN) and a primer mix (each primer at a final concentration of 0.2 µM) ...
-
bioRxiv - Genetics 2020Quote: ... AC7594-5’-CCGCCTATCCTCGTCATGAAC)andcontrolALG9primers(AC5067-5’-CACGGATAGTGGCTTTGGTGAACAATTAC;AC5068-5’-TATGATTATCTGGCAGCAGGAAA GAACTTGGG) (0.5 µM) and QuantiTect SYBR Green PCR master mix (Qiagen) on a StepOnePlus Real-Time PCR machine (Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: RNA extraction from sorted CD8 T cell populations pooled from 5-7 mice (week 5 and 8 p.i.) was performed using the RNeasy Plus mini kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... which was then homogenized with a steel bead in a Qiagen TissueLyser LT (QIAGEN). RNA was precipitated with chloroform and cleaned up using the RNeasy Mini Kit (QIAGEN ...
-
bioRxiv - Microbiology 2021Quote: Lung viral loads were collected from right lower lobes using tungsten carbide beads (Qiagen) in a TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... following homogenization with a bead beater and passage through a QIAshredder (Qiagen, Germantown, MD). 5 µg of cDNA was reverse transcribed using the SuperScriptTM First Strand Synthesis kit following the manufacturer’s instructions for use with OligoDT (Thermo Fisher Scientific Waltham ...
-
bioRxiv - Molecular Biology 2020Quote: ... The lysate was cleared and bound to pre-equilibrated Ni-NTA agarose beads (Qiagen) for 1.5 h ...
-
bioRxiv - Biophysics 2021Quote: ... coli and purified by His-tag affinity purification using Ni-NTA agarose beads (Qiagen) followed by ion exchange purification using a mono-Q HR 5/5 column (GE Healthcare) ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was eluted by vortexing the beads vigorously in 350 μl RLT (Qiagen, 79216). Eluted RNA was purified using RNeasy Micro kit (Qiagen).
-
bioRxiv - Neuroscience 2021Quote: ... The tissue was homogenized by adding a stainless-steel bead (Qiagen, Cat. No. #69989) into each tube and shaking the tubes in the TissueLyser (TissueLyser II ...