Labshake search
Citations for Qiagen :
751 - 800 of 10000+ citations for Human Oligodendrocyte transcription factor 1 OLIG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Uninfected or infected primary human macrophages were subjected to RNA extraction using RNeasy Mini Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... mouse organ lysates and human primary cell supernatant samples were prepared in RNeasy Mini Kit (Qiagen) lysis buffer RLT (400μl) ...
-
bioRxiv - Cancer Biology 2020Quote: ... human FLMs and adjacent normal tissue was performed using the AllPrep DNA/RNA Mini Kit (Qiagen). Whole exome sequencing was performed by Novogene using their standard protocols ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA of mouse and human intestinal tissue was isolated using the RNeasy Mini Kit (Qiagen) and total RNA of mouse mesenteric fat was isolated using the RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Physiology 2023Quote: ... and grown to confluency and transfected with human Leptin constructs using Effectene kit (Cat# 301427, QIAGEN).
-
bioRxiv - Cancer Biology 2023Quote: gDNA was isolated from human sarcoma models and controls using the QIAamp DNA Mini Kit (Qiagen). Library preparation was performed by the Functional Genomics Laboratory (FGL) ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was isolated from human primary immune cells using the RNeasy Plus Micro Kit (Qiagen). RNA integrity number (RIN ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from human sarcoma models and controls using the RNeasy Mini Kit (Qiagen). Library preparation was performed by the Functional Genomics Laboratory (FGL) ...
-
bioRxiv - Cell Biology 2020Quote: ... Recovered RNA was quantified using a Nanodrop spectrophotometer and equal amounts of total RNA were transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen, Manchester, UK). Analysis of target gene expression was performed through Power SYBR Green Master Mix (Life Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 0.1 and 1.0 μg (region dependent) of normalized sample were used for cDNA synthesis using QuantiTect Reverse Transcription Kits (Qiagen, Valencia, CA, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was quantitated using Nanodrop ND-2000 and cDNA was synthesized from 500 ng of total RNA using a Quantitect® reverse transcription kit (Qiagen, USA). Gene expression analysis of TET 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 µg of extracted RNA was reverse transcribed into cDNA according to manufacturer’s instructions using the QuantiTect Reverse Transcription Kit (QIAGEN; Venlo, The Netherlands). Quantitative gene expression analysis was performed using the LightCycler® 480 SYBR Green I Master (Roche ...
-
bioRxiv - Genomics 2020Quote: ... Sample L5630 underwent a target enrichment approach where double stranded DNA (synthesized using the QuantiTect Reverse Transcription Kit from Qiagen, Hilden, Germany) was amplified using 26 overlapping primer sets covering most of the SARS-CoV-2 genome as recently described by our group [9] ...
-
bioRxiv - Microbiology 2020Quote: ... 21 and 28 days post inoculation (dpi) and 2 μg was used to synthesize cDNA using the QuantiTect® Reverse Transcription Kit (Qiagen, CAD) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of subgenomic RNA was performed by real-time reverse transcription PCR (RT-PCR) using a QuantiTect Probe RT-PCR Kit (QIAGEN, Hilden, Germany) with primers and probes as previously described [39] ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 ng of each sample was used per reverse transcription-quantitative polymerase chain reaction (RT-qPCR) reaction using the QuantiTect SYBR® Green RT-PCR Kit (Qiagen, 204243) on Rotor-Gene Q (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative real-time reverse transcription PCR (qRT-PCR) was carried out with the QuantiNova SYBR Green RT-PCR kit (Qiagen, Manchester USA) using a LightCycler® 480 Instrument II (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instruction and the resulting cDNA was used for reverse transcription-polymerase chain reaction (RT-PCR) using HotStarTaq Plus Master Mix Kit (Qiagen, Germantown, MD). The PCR conditions used were as follows ...
-
bioRxiv - Immunology 2023Quote: ... from each RNA sample was synthesized in two separate technical replicates from 150 ng of total RNA using QuantiTect Reverse Transcription Kit (Qiagen, cat.: 205311), according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: From 0.5 μg to 200 ng of total RNA was reverse-transcribed using the QuantiTect® Reverse Transcription Kit (Qiagen, Hilden, Germany). Gene expression levels were evaluated by qPCR using primers reported in Table S9 ...
-
bioRxiv - Bioengineering 2021Quote: Genomic DNA from human primary CD4+/CD8+ T cells was isolated using the Gentra Puregene Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA (gDNA) from human blood cells was isolated using the QIAamp Blood kit (QIAGEN, Hilden, Germany). To isolate gDNA from different mouse tissues we made use of the blackPREP Rodent Tail DNA Kit (Analytik Jena ...
-
bioRxiv - Cancer Biology 2020Quote: Total genomic DNAs (containing human and viral genomes) were isolated using AllPrep DNA/RNA Mini Kit (Qiagen) from the NPC biopsy ...
-
bioRxiv - Cancer Biology 2020Quote: DNA from human and murine PC cells were isolated using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... Genomic human DNA was isolated from whole blood using QIAamp DNA Blood Mini Kit from Qiagen (51106) and phosphodiester DNA from TIB Molbiol ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Genetics 2019Quote: RNA was extracted from PCYT1A-wild-type human fibroblasts using the RNeasy Mini Kit (Qiagen, Cat#74104), reverse-transcribed according to the manufacturer’s protocol (SuperScriptIII One-Step RT-PCR system with Platinum Taq DNA Polymerase;Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA of human macrophages was isolated according to manufacturer’s instructions using the RNeasy extraction kit (Qiagen). mRNA was extracted using the Next Poly(A ...
-
bioRxiv - Cell Biology 2023Quote: Uninfected or infected primary human macrophages were subjected to RNA extraction using the RNeasy extraction kit (Qiagen). Two µg of RNA each was reverse transcribed with the iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Immunology 2022Quote: Genomic DNA was purified from human peripheral blood mononuclear cells (PBMCs) using QIAamp kits (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: RNA from 1205Lu cells and immortalized human melanocytes were isolated and purified using RNeasy Micro Kit (Qiagen) according to manufacturer’s instruction and concentration was quantified using a NanoDrop Spectrophotometer (ThermoScientific) ...
-
bioRxiv - Genomics 2024Quote: ... the effect of human rRNA removal was also assessed using a QIAseq FastSelect rRNA removal kit (Qiagen). The rRNA removal reaction was performed after RNA thermal denaturation at 95℃ 5 min according to the instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen, Hilden, Germany) or TRIzol reagent (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2024Quote: The RNA quality of human kidney FFPE sample was checked by RNeasy FFPE kit (Qiagen-Cat #73504) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Reverse transcription was performed using OmniScript reverse transcriptase (Qiagen) and oligo-dT primers ...
-
bioRxiv - Physiology 2020Quote: ... Reverse transcription was performed using Omniscript reverse transcriptase (Qiagen) at 37°C for 60 min.
-
bioRxiv - Microbiology 2023Quote: ... Transcription was blocked applying RNA Protect Bacteria solution (Qiagen). RNA was quality-checked using an Agilent Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Microbiology 2019Quote: ... Cignal EGR-1 reporter kit (Qiagen) was transfected in HEK293T following manufacturer protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA synthesis was performed on the Bio-Rad T100 PCR Gradient Thermal Cycler using the QuantiTect® Reverse Transcription kit (Qiagen, Germantown, MD), following manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Total extracted RNA was resuspended in nuclease free water and one microgram was used for cDNA synthesis using the Quantitect reverse transcription kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Following the manufacturer’s instructions RNA was reverse-transcribed in a 20 μl reaction volume (42°C, 30 min; 95°C, 5 min) using a QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). cDNA was then amplified using a SYBR Green I Master mix (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... Reverse transcription with 50 ng of RNA into a cDNA library was performed using the Omniscript RT kit (#205111, QIAGEN, Inc.; Germantown, MD) and random nonamers (Integrated DNA Technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA synthesis was performed on the Bio-Rad T100 PCR Gradient Thermal Cycler using the QuantiTect® Reverse Transcription kit (Qiagen, Germantown, MD), following manufactureŕs instructions.
-
bioRxiv - Microbiology 2019Quote: Microbial genomic DNA was extracted from the human stool samples using the DNeasy PowerSoil DNA Isolation Kit (Qiagen). The V4 region of 16S rRNA gene was amplified and sequenced using the Illumina MiSeq platform(67) ...
-
bioRxiv - Cancer Biology 2020Quote: ... human HDL (40nM) or PBS for 48 hours prior to RNA isolation using the RNeasy Mini kit (Qiagen). RNA samples were converted to cDNA libraries by the Northwestern University Genomics Core facility and were then run on the Illumina HT-12 microarray ...
-
bioRxiv - Microbiology 2021Quote: ... Cell-free cfDNA (both human and mouse) was isolated with QIAamp DSP Circulation NA Kit (QIAGEN, Hilden, Germany) following the manufacturer’s protocol ...