Labshake search
Citations for Qiagen :
601 - 650 of 1140 citations for IL 5 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The clarified cell lysate was loaded onto a 5 mL Ni-NTA superflow cartridge (Qiagen), washed with buffer A ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS ...
-
bioRxiv - Microbiology 2022Quote: ... The filtered lysate was then loaded onto a 5 ml Ni-NTA Superflow column (Qiagen), and the column was washed with buffer A containing 10 mM imidazole ...
-
bioRxiv - Biophysics 2022Quote: ... Digested and 5’ dephosphorylated vector was purified using the QiaQuick PCR Cleanup kit (Qiagen, Germany). Both inserts and vector were eluted and stored in 10 mM Tris-Cl ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from 5 million cells using RNeasy Plus Universal Kits (Qiagen, #73404) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... single-cells were sorted in 96-well plates containing 5 µL of TCL buffer (Qiagen) with 1% β-mercaptoethanol according to the gating strategy shown in Fig ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Supernatant was removed and incubated with 5 mL of pre-equilibrated Ni-NTA resin (Qiagen) for one hour at 4 °C with gentle shaking ...
-
bioRxiv - Biochemistry 2023Quote: ... the supernatant was loaded onto a 5 mL column of Ni-NTA agarose (Qiagen, Inc.) pre-equilibrated with buffer A ...
-
bioRxiv - Physiology 2023Quote: ... using a Qiagen TissueLyser LT bead mill and 5-mm stainless steel beads (Qiagen, #69989). RNA was isolated from the samples using the NucleoSpin RNA kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Lysate was then batch bound to 5 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) resin at 4ºC for 2 hours in a beaker set on a stir plate ...
-
bioRxiv - Pathology 2023Quote: Mouse tissues were homogenized with a 5 mm steel bead using a TissueLyser II (QIAGEN) for 5 min at frequency of 30 times/second ...
-
bioRxiv - Biochemistry 2023Quote: ... The cleared lysate was loaded onto two 5 mL Ni-NTA Superflow cartridges (QIAGEN, 30761) equilibrated with lysis buffer and washed with 10 column volumes of washing buffer containing 20 mM Tris pH 8.0 ...
-
bioRxiv - Systems Biology 2023Quote: Approximately 5 mg of frozen prefrontal cortex was homogenized in 1 ml RLT buffer (Qiagen) using a BeadBeater (BioSpec ...
-
bioRxiv - Neuroscience 2023Quote: ... Supernatants containing soluble proteins were applied to a 5 mL NiNTA-agarose gravity column (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified lysate was then incubated with 5 mL of Ni-NTA agarose beads (Qiagen), pre-equilibrated in lysis buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Cleared lysate was briefly incubated (approximately 5 min) with 3 ml Ni-NTA Agarose (QIAGEN) before flow-through was collected ...
-
Sex-specific fear acquisition following early life stress is linked to amygdala glutamate metabolismbioRxiv - Animal Behavior and Cognition 2024Quote: ... which had been preprocessed with 5 mm metal balls in a TissueLyser (Qiagen, TissueLyser LT) for 1 minute at 25 Hz ...
-
bioRxiv - Developmental Biology 2024Quote: ... and RNA purified from 5-dpf embryos with the miRNeasy Mini Kit (Qiagen, catalog #: 217004). Using this cDNA library ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA from magnetically purified human NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 4) hiPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 3) human iPSC-derived neurons was prepared using miRNeasy Micro Kit (Qiagen Cat. 217084), based on manufacturer’s procedures ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, PSEN1A246E, and PSEN1H163R (replicates, n = 3) human iPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen, Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from cultured from human bronchial epithelial cells / mice right lung tissues and purified using the Qiagen AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany), supplemented with the Proteinase K (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... we extracted whole blood DNA from all individuals included in the RNA sequencing data using Gentra® Puregene® for human whole blood kit (QIAGEN) and MagAttract® HMW DNA kit (QIAGEN ...
-
bioRxiv - Genetics 2019Quote: Total RNA from human cell lines (PTC-05, HepG2 and HEK-293T) was extracted using spin columns with the RNeasy Mini Kit (QIAGEN, GmbH, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... The expression of the BCL-2 anti-apoptotic genes in the NPC cell lines were accessed using the custom RT2 Human Apoptosis Profiler PCR array (Qiagen, Hilden, Germany). To delineate the contribution of MCL-1 for cell survival ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA from Amborella generative cells and sperm cells was extracted according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN, Hilden, Germany). In brief ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out by using the ‘Human Innate and Adaptive immune Response’ kit (Qiagen, Hilden, Germany) to assess the expression of genes/mRNA ...
-
bioRxiv - Microbiology 2023Quote: ... 293A cells were transfected with the plasmid of pCDNA3.1-ACE2 (human)-3×FLAG (MiaoLing Plasmid Platform, China) using polyfect (QIAGEN, West Sussex, UK) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from 1 mL of each human plasma sample using the DNeasy Blood and Tissue kit (Qiagen, 69504, Hilden, Germany) according to the manufacturer protocol and recommendations ...
-
bioRxiv - Microbiology 2023Quote: Microbiome DNAs were extracted from the human samples on the same day of collection using the microbiome-specific kit (QIAamp DNA Microbiome Kit; Qiagen, Hilden, Germany). The DNA extraction was performed according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Subsequent targeted sequencing of 160 cancer-related genes was performed using a QIAseq Human Comprehensive Cancer Panel v2 (Qiagen Inc, Valencia, CA) (Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... Key genes involved in the regulation and enzymatic pathways of fatty liver were simultaneously assayed with the RT2 Profiler PCR Array Human Fatty Liver (PAHS-157ZC-6) (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions and analyzed with the Data Analysis Center (QIAGEN Hilden ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 ng of RNA from microdissected human pancreatic islets and from EndoC-βH1 was used to generate cDNA libraries using QiaSeq miRNA library kit (Qiagen, Hilden, Germany) following manufacturer’s instructions (see ESM Methods).
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted from FACS sorted mouse brain cells stabilized in RNAprotect buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN, Hilden, Germany). In brief ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Developmental Biology 2021Quote: ... were first frozen in liquid nitrogen and then homogenized with a 5 mm ∅ metal bead (Qiagen) for 2 min at 40 Hz using TissueLyser LT (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... using stainless steel beads (5 mm mean diameter) and a TissueLyser LT adapter (Qiagen, Hilden, Germany) for 5 min at 50 Hz ...
-
bioRxiv - Immunology 2021Quote: ... the supernatant/Sepharose bead slurry was passed through a 5 ml polypropylene gravity flow column (Qiagen). The column was washed with 1 column volume of PBS before being eluted with 9 ml of Elution Buffer (0.1M Glycine/HCl buffer ...
-
bioRxiv - Genetics 2019Quote: ... for lysis in 2 ml safe-lock tubes containing one 5 mm stainless steel bead (Qiagen) for 2.5-3 minutes at 30 Hz using TissueLyzer II (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... All wells were then pooled and diluted 5:1 (∼24 mL) in Buffer PB (Qiagen #19066) with 1/20th volume of 3 M NaOAc pH 5.2 (∼1.2 mL) ...
-
bioRxiv - Pathology 2019Quote: ... The Pparα deletion was confirmed with PCR and HotStar Taq DNA Polymerase (5 U/μl, Qiagen) using the following primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... and resuspended in 10 mM Tris pH8 (500 μL) with 5 μL RNase A (Qiagen 19101) for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131 ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the tube together with a 5 mm stainless steel bead (Qiagen, Maryland, USA). The sample was homogenized for two minutes at 30 Hz using a TissueLyser II (Qiagen ...