Labshake search
Citations for Qiagen :
851 - 900 of 1140 citations for IL 5 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genetics 2021Quote: ... and E11 (5’-AGGAAAAAGGAAATAAATTA-3’) primers on pDH373 as a template generated a smaller fragment that was cleaned up by QIAGEN MinElute PCR Purification Kit (#28004) ...
-
bioRxiv - Genetics 2021Quote: Pools of 5 mites were ground to powder in liquid nitrogen and total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Genetics 2020Quote: ... in a 2 ml Eppendorf (Hamburg, Germany) tube using Stainless Steel Beads (5 mm) and the TissueLyzer (QIAGEN, Venlo, Netherlands). After an incubation time of 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were transfected at 60-80% confluence with 5 nM/1nM (MIN6, EndoCβ-H1, respectively) control or miR-125b mimics (Qiagen) or 50 nM of a mixture of four ONTARGETplus siRNAs against mouse Smad2 ...
-
bioRxiv - Microbiology 2019Quote: ... Epithelial cells were then recovered and stabilised by pelleting at 1000 rpm for 5 minutes followed by lysis in buffer RLT RNA lysis solution (Qiagen).
-
bioRxiv - Biochemistry 2021Quote: ... The RNA was prepared from 5 OD equivalents of stressed and unstressed cells using the RNeasy Plus RNA Isolation Kit (Qiagen). 500 ng RNA of the total isolated RNA were used as a template for the synthesis of cDNA using Oligo(dT ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were then aspirated using a freshly flame-pulled patch pipette (2.5 inner diameter) and placed into a 5 μl of lysis Buffer TCL (Qiagen, 1031576) + 1% 2-mercaptoethanol (Millipore-Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... LRRCC1-si2 (target sequence: 5’- TTA GAT GAC CAA ATT CTA CAA - 3’) and control siRNA (AllStars Negative Control) were purchased from Qiagen. siRNAs were delivered into cells using Lipofectamine RNAiMAX diluted in OptiMEM medium (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Immunology 2019Quote: ... Approximately 20 mg of jejunum were mixed with 600 μL of the prepared protein lysis buffer and homogenized using 5 mm stainless steel beads (Qiagen) and a TissueLyser II system (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: Total RNA was isolated from adult anaemic spleen 5 days after phenylhydrazine injections [56] using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: DNA and RNA were extracted from the cervical cancer tissues (5-10 mg) using the AllPrep DNA/RNA Micro Kit (QIAGEN) as described by the manufacturer ...
-
bioRxiv - Immunology 2019Quote: ... longitudinal muscle/myenteric plexus preparations were homogenized in a 2 ml eppendorf containing 1 ml Trizol and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Immunology 2019Quote: ... mucosal scrapings and feces were homogenized in a 2 ml eppendorf containing 1 ml of DNA extraction buffer and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Microbiology 2019Quote: ... 3 and 5 dpi maize leaves were ground in liquid nitrogen and total DNA was isolated with DNeasy Plant Mini kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs used were: AllStars Negative control siRNA (cat# 1027281) and si-Rab13 #8 (cat# SI02662702; target sequence: 5’-ATGGTCTTTCTTGGTATTAAA-3’) from Qiagen.
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted from 1∼5 million PBMCs into 30ml of water with RNeasy Mini Kits (Qiagen, Valencia, CA). For unbiased repertoire analysis ...
-
bioRxiv - Genomics 2019Quote: ... We used a 100 µm nozzle to sort single cells into 96-well plates containing 5 µl TCL buffer (Qiagen) with 1% beta-mercaptoethanol for Smart-seq2 and 384-well plates containing 0.6 µl 1% NP40 (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and dARC1 CA captured from clarified lysate using immobilised metal ion affinity on a 5 mL Ni2+-NTA superflow column (Qiagen). Bound dARC1 CA was eluted in non-reducing buffer (50 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng equivalent of pooled total RNA (5 slices per animal; 7 rats) was used to synthesize cDNA using an RT First Strand Kit (Qiagen). Pre-validated primers targeting rat CXCR4 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The entire flies were mechanically crushed for 30 s at 25 Hz using a 5-mm stainless steel bead in a TissueLyser (Qiagen). Three hundred μL of ACL solution and 20 μL of 16 g.L-1 proteinase K were then added to the samples ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 250 plants showing the long root phenotype of the revertant were selected at 5 DAS and pooled for DNA extraction using the DNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... followed by flow sorting with a Sony SH800Z (gating on calcein NVOC fluorescence levels) into individual wells of a 96-well plate containing 5 μL of Buffer RLT (Qiagen) and 1% β-mercaptoethanol.
-
bioRxiv - Cancer Biology 2021Quote: Driver mutations were derived from.15 CopyNumbers were calculated using the CNVKit package.16 RNA was isolated from cell cultures (+/− 5 μM AGI-5198) using the RNeasy kit (Qiagen). We performed paired-end sequencing of 2×100 with the Illumina Novaseq platform to obtain 8-10 GB per sample ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 to 20 mg of frozen tissue was dissociated using 400 μl of RLT Plus in a 2mL extraction tube containing a 5 mm diameter beads (Qiagen) and agitated at 30 HZ for twice 2 minutes in the TissueLyser II (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... a volume equivalent to 5×108 cells were spun down (assuming 1 OD600=8×108 cells) and Protect Bacteria RNA Mini Kit (Qiagen) was used to extract total RNA as described in (Bhattacharyya et al. ...
-
bioRxiv - Cancer Biology 2019Quote: Tumour tissue were collected into 2 ml tubes with pre-chilled steel beads (Qiagen Stainless Steel Beads, 5 mm, 69989) and stored at −80 °C freezer ...
-
bioRxiv - Neuroscience 2020Quote: RNA was extracted from third-instar larval CNS or adult heads (5-7 days post-pupation) with RNeasy Plus Micro kit (Qiagen). RNA isolation was followed with DNase digestion with Turbo DNA-free (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Bacterial cultures (5 to10 mL) from mid-exponential phase (OD600 = 0.5-0.6) were harvested and treated with RNAprotect reagent (Qiagen, Germantown, MD), and the cell pellet ...
-
bioRxiv - Cell Biology 2021Quote: Isolated Tert+ and Tert-cells (≤ 5 cells) were subjected to synthesize the complementary DNA (cDNA) using REPLI-g WTA Single Cell Kit (QIAGEN) and analyzed for gene expression by qRT-PCR ...
-
bioRxiv - Microbiology 2020Quote: ... mexicana Cas9 T7 procyclic promastigotes were transfected either with whole PCR reactions or 5 µL of DNA purified using the QIAquick PCR Purification Kit (Qiagen). 8 x 106 log phase cells were prepared by spinning down (1,000 x g for 10 min) ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.5-1 μg of total RNA was reverse transcribed into first-strand cDNA using an RT2 First Strand Kit (QIAGEN). The resultant cDNA was subjected to qPCR using human cytokine-specific primer (Realtimeprimers.com ...
-
bioRxiv - Microbiology 2020Quote: ... Purified extracellular WT and Δtgif2k-b tachyzoites were treated with vehicle or 5 μM sodium arsenite for 2 h at 37°C and total RNA was extracted using RNeasy (Qiagen). The RNA concentration for each sample was measured using Nanodrop One (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2020Quote: ... All other tissues were homogenized in a SPEX CertiPrep 2010-230 Geno/Grinder (Cat No.: 12605297, Fischer Scientific) using 5 mm steel beads (Cat No.: 69989, Qiagen); tubes were shaken in 20 sec bursts at 1500 rpm ...
-
bioRxiv - Plant Biology 2021Quote: RNA was isolated from adult (5-week-old) WT and er/erl1/erl2 plants using a Plant RNeasy kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... ∼2.5×108 cells (0.5 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples from the GSK-3484862 and 5-azacytidine treated assays had RNA and DNA isolated simultaneously using the AllPrep DNA/RNA kit (Qiagen), whereas only RNA was isolated from decitabine samples by using the RNAzol total RNA protocol (Sigma) ...
-
bioRxiv - Microbiology 2022Quote: ... Nasal turbinates and lungs were collected from a subset of hamsters at 4 dpi and homogenized in 1ml or 5 ml of PBS with TissueRuptor (Qiagen), respectively ...
-
bioRxiv - Plant Biology 2022Quote: Grains were homogenized using mortar and pestle with liquid nitrogen while other tissues were homogenized in SPEX CertiPrep 2010-230 Geno/Grinder (Cat No.: 12605297, Fischer Scientific) using 5 mm steel beads (Cat No.: 69989, Qiagen). For grain samples ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 5-day-old vertically grown Arabidopsis thaliana seedlings root tissue using RNeasy Mini Kit (Qiagen, www.qiagen.com) with on-column DNA digestion to remove residual genomic DNA using RNase-free DNase according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... to produce 75-base pair single-end reads with aimed mean sequencing depth of >5 M reads per sample as recommended by the manufacturer (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... Blood was collected by cardiac puncture and harvested organs were homogenized in 500 μl PBS with two 5 mm stainless steel beads using a tissue lyser (Tissue-Lyser II, Qiagen) for two 2-minute rounds at 30 Hz and centrifuged to pellet debris for 10 minutes at 8,000 rpm ...
-
bioRxiv - Microbiology 2021Quote: ... placed in 250 μL PBS containing a 5 mm stainless steel bead and homogenized using a tissue lyser (Tissue-Lyser II, Qiagen) for 2-minutes at 30 Hz ...
-
bioRxiv - Microbiology 2020Quote: ... All samples were then passed 3-5 times through a 26G needle prior to RNA isolation using the RNAeasy mini kit from Qiagen. RNA concentrations were estimated by absorbance measurement at 260 and 280 nm ...
-
bioRxiv - Immunology 2020Quote: ... Equal volumes of barcoded PCR2 products (5 μL each) were pooled and PCR column purified using QIAquick PCR Purification Kit (Qiagen). Libraries were quantified using KAPA Library Quantification Kit for Illumina Platforms (Kapa Biosystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... confluent 293T-REx cells (25 cm2) were harvested and nuclei were isolated from 5×106 cells with the Qproteome Cell Compartment Kit (QIAGEN), according to the manufacturer’s instructions ...