Labshake search
Citations for Qiagen :
551 - 600 of 6183 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... All primers were purchased from Quantitect Primer assay ((Qiagen N.V. ...
-
bioRxiv - Neuroscience 2023Quote: ... Adequate sensitivity of the assay was initially confirmed using methylated and unmethylated DNA standards from the EpiTect PCR Control DNA Set (Qiagen).
-
bioRxiv - Neuroscience 2023Quote: ... Adequate sensitivity of the assays was assessed as described earlier using (un)methylated DNA standards from the EpiTect PCR Control DNA Set (Qiagen).
-
bioRxiv - Bioengineering 2022Quote: ... for aliquoting into a 384-well RT2 Profiler PCR Array with genes from the Mouse Inflammatory Response and Autoimmunity set (Qiagen). Plates were analyzed with the Applied Biosystems™ QuantStudio™ 6 Flex Real-Time PCR System ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was conducted using specific 10x QuantiTect primers diluted in 1.1 mL TE pH 8.0 (Qiagen). The genes that were analyzed were Adcy1 (QT00386421) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 1μl of primer mix (consisting of the forward and reverse primers of comp162710 at a concentration of 0.2μM) and 1μl of QIAGEN Multiplex PCR Mastermix (Qiagen). The length of amplified fragments was determined by gel electrophoresis ...
-
bioRxiv - Cancer Biology 2021Quote: ... Gene-specific primers (supplementary table S9) were used for end-point PCR (HotStarTaq Plus DNA Polymerase; Qiagen), to detect different sized amplicons on agarose gels (1.5%) ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were purified and annealed with the sequencing primer for pyrosequencing using the PyroMark Q24 (Qiagen).
-
bioRxiv - Immunology 2022Quote: ... and loaded to RT2 Profiler PCR Arrays containing primers for antifungal genes (PAMM-147ZD; table S2; Qiagen). The RNA load was normalized with Actb ...
-
bioRxiv - Cell Biology 2021Quote: ... the ViiA 7™ Real-Time PCR system was used to run the Human Stem Cell RT² Profiler™ PCR Array (Qiagen, Hilden, Germany). For the analysis of cardiac differentiation-associated genes ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA quantity was measured using nanodrop and qRT-PCR assays were performed using QuantiNova™ SYBR Green RT-PCR Kit (Qiagen, Cat.# ID: 208154) in StepOnePlus™ Real-Time PCR System by Applied biosystems ...
-
bioRxiv - Genetics 2021Quote: ... Amplification products from semi-quantitative RT-PCR were gel-purified using the QIAquick gel extraction kit (Qiagen) and Sanger sequenced ...
-
bioRxiv - Cancer Biology 2019Quote: Real time RT-PCR was performed using total RNA isolated on RNeasy Quick spin columns (QIAGEN, CA). One μg of total RNA was used to perform reverse transcriptase–polymerase chain reaction (RT-PCR ...
-
bioRxiv - Genomics 2019Quote: ... Gene expression levels were determined by qPCR using miScript II RT and SYBR Green PCR kits (Qiagen) and results were normalized to the housekeeping gene Hprt1 ...
-
bioRxiv - Bioengineering 2021Quote: ... Quantitative RT-PCR Array: Total RNA from microfluidic channels was purified using an RNeasy Mini Kit (Qiagen). Next ...
-
bioRxiv - Neuroscience 2020Quote: ... The RNA was subsequently transcribed into cDNA using the OneStep RT-PCR Kit from QIAGEN (Catalog # 210212) with the following thermocycler program ...
-
bioRxiv - Microbiology 2020Quote: ... A 20 µL reaction mix containing 12.5 µL of 2X Quantitect Probe RT-PCR Master Mix (Qiagen), 0.5 µL of RT mix from the kit ...
-
bioRxiv - Microbiology 2020Quote: ... Viral genomic RNA (gRNA) was detected with a one-step real-time RT-PCR assay (Quantifast, Qiagen) using primers and probes generated to target either the SARS-CoV-2 E (28 ...
-
bioRxiv - Cell Biology 2021Quote: ... Two micrograms of RNA was used for reverse transcription with Rotor-Gene SYBR Green RT-PCR (QIAGEN) or The SensiMix™ SYBR® No-ROX (BioLine ...
-
bioRxiv - Cell Biology 2021Quote: ... Two micrograms of RNA was used for reverse transcription with Rotor-Gene SYBR Green RT-PCR (QIAGEN) or The SensiMix™ SYBR® No-ROX (BioLine ...
-
bioRxiv - Immunology 2020Quote: ... Real-time quantitative PCR (RT-qPCR) was performed on a Rotor-Gene Q2plex real-time cycler (Qiagen). For relative gene expressions of IL6 and CXCL8 ...
-
bioRxiv - Cell Biology 2021Quote: The RT-qPCR for Miro1 and PCR for mitochondrial DNA was performed on Rotor gene Q (Qiagen). Relative gene expression of Miro1 and mitochondrial DNA copy number were evaluated using their specific forward and reverse primers as indicated in Table 2 ...
-
bioRxiv - Microbiology 2021Quote: ... RORC1 and RORC2 gene expression was evaluated by One step SYBR green real-rime RT-PCR (Qiagen) using a Light-Cycler 480 II as follows ...
-
bioRxiv - Plant Biology 2023Quote: ... or 500 ng of total RNA for reverse transcription using the One Step RT PCR-Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 200 ng of RNAs were reverse transcribed and amplified using the OneStep RT-PCR kit (Qiagen Inc.). MTA1 and EF1α (FGRRES_08811 ...
-
bioRxiv - Biochemistry 2023Quote: ... The RT-quantitative PCRs were carried out in four biological replicates in a 96-well plate (QIAGEN) using a QIAcuity system (QIAGEN) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or miR-200b/200c on the ZC3H11A 3’UTR were obtained from Qiagen. TSBs were resuspended in ddH2O to prepare a 50 µM solution ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-hsa-miR-181a-5p miScript miRNA Inhibitor (20 nmol, Qiagen, cat# MIN0000256).
-
bioRxiv - Cancer Biology 2022Quote: ... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
bioRxiv - Cell Biology 2019Quote: ... Human primers were pre-validated Quantitect primers (Qiagen, Manchester, UK). Comparative quantification normalised target gene mRNA to β-actin (ACTB ...
-
bioRxiv - Cell Biology 2021Quote: ... Validated qPCR primers and primer assays (Qiagen, see Table 1) were used together with QuantiTect SYBR Green PCR kit (QIAGEN ...
-
bioRxiv - Plant Biology 2020Quote: ... An RNase-Free DNase Set (Qiagen) was used to remove genomic DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... with RNase-Free DNase Set (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... with RNase-Free DNase Set (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: Individual set of two siRNAs (Qiagen) against HNF1B or ERG were tested in knockdown efficiency and compared with the siRNA negative-control (Qiagen ...
-
GFI1 cooperates with IKAROS/IKZF1 to activate gene expression in T-cell acute lymphoblastic leukemiabioRxiv - Biochemistry 2021Quote: ... and RNase- Free DNase Set (Qiagen). RNA integrity numbers (RIN ...
-
bioRxiv - Immunology 2022Quote: ... and RNase-Free DNase Set (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... The RNase-free DNase Set (Qiagen) was used for on-column DNase digestion ...
-
bioRxiv - Genetics 2019Quote: ... and RNase-Free DNase Set (QIAGEN). Adaptors as well as low quality base pairs were trimmed ...
-
bioRxiv - Microbiology 2021Quote: ... The RNase-Free DNase Set (Qiagen) treatment was applied to all samples according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... and RNase-free DNase Set (Qiagen). Infection was confirmed by RT-qPCR using specific primers to detect HDV transcripts.
-
bioRxiv - Systems Biology 2023Quote: ... and RNase-Free DNase Set (QIAGEN) according to the product instructions ...
-
bioRxiv - Immunology 2023Quote: ... with Rnase-Free DNase set (Qiagen). The RNA was eluted with RNAse-free H2O in final volume of 20μl and stored at -80°C.
-
bioRxiv - Cell Biology 2023Quote: ... and RNase-Free DNAse Set (Qiagen). Total RNA (150 ng ...
-
bioRxiv - Immunology 2023Quote: ... including RNase-Free DNase Set (Qiagen) treatment ...
-
bioRxiv - Immunology 2023Quote: ... and RNase-Free DNase Set (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... including RNase-Free DNase Set (Qiagen) treatment ...
-
bioRxiv - Microbiology 2023Quote: ... and RNase-free DNase Set (Qiagen) on-column DNA digestion ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and RNase-Free DNase Set (QIAGEN) according to product instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and RNase-free DNase Set (Qiagen) on-column DNA digestion ...