Labshake search
Citations for Qiagen :
551 - 600 of 3538 citations for Monocyclohexyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... proteins were purified by batch Ni-NTA bead purification (1 mL slurry/1L culture; Qiagen) and further purified by a Superdex 200 16/60 column (GE Healthcare ...
-
bioRxiv - Genomics 2020Quote: ... The supernatant of cell lysate was incubated with 1 mL Ni-NTA agarose beads (QIAGEN) at 4 °C for 1 h ...
-
bioRxiv - Genomics 2019Quote: ... cfDNA was extracted from 1 or 4 ml of urine according to manufacturer recommendations (Qiagen Circulating Nucleic Acid Kit ...
-
bioRxiv - Cell Biology 2019Quote: ... Co-NTA beads were obtained from stripping 1 mL of Ni-NTA resin from Qiagen in a Bio-rad gravity column with 50 mL of 0.5M EDTA (pH 8.0) ...
-
bioRxiv - Biochemistry 2021Quote: ... and the membrane suspension was mixed with 1 ml of Ni-NTA Superflow resin (Qiagen) per 1mg of GFP–His8 and incubated for 3 hours at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 °C) and the supernatant was then loaded onto 1 ml HisTrap HP column (Qiagen) at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Cell debris were eliminated by centrifugation and 1 mL of Ni-NTA superflow beads (Qiagen) was added to bind his-tagged proteins ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reverse cross-linking was performed by the addition of 0.2 mg ml-1 RNaseA (Qiagen) and 0.2 mg ml-1 Proteinase K (Promega) ...
-
bioRxiv - Molecular Biology 2022Quote: The supernatant was mixed with 1 ml resin volume of Ni-NTA beads (Qiagen, 30210) which was pre-equilibrated with Lysis buffer supplemented with 40 mM imidazole and 0.1 mM ATP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the supernatant was purified by 1 mL Ni2+ IMAC with Ni-NTA Superflow resins (Qiagen). Resins with bound cell lysate were washed with 10 mL (bed volume 1 mL ...
-
bioRxiv - Microbiology 2020Quote: ... homogenized in 1 ml of PBS with a steel ball by a Tissue Lyser (Qiagen) at 25 Hz for 1 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... the mixture was left to incubate in batch with 1 mL Ni-NTA resin (QIAGEN) overnight at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... Samples (0.5–1×106 cells) were resuspended in 50μl of 100μg/ml RNase A (Qiagen). PI (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... after which the cells were stained with anti-Penta-His-AF647 (1 µg/mL; Qiagen) for 30 minutes at 4°C ...
-
bioRxiv - Genetics 2022Quote: ... 1 ml of each pooled PCR was purified using the QIAquick PCR Purification Kit (Qiagen), loaded on a 1% agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen).
-
bioRxiv - Microbiology 2022Quote: ... Cell pellets were thawed and resuspended in 1 mL QIAzol Lysis Reagent (QIAGEN, Hilden, Germany) and homogenized using a BioSpec Products BeadBeater-24 (Bartlesville ...
-
bioRxiv - Microbiology 2022Quote: ... and the entire spleen were harvested and homogenized in 1 ml PBS using TissueRuptor (Qiagen). These homogenates were serially diluted and plated on agar plates to determine the number of colonized bacteria in each organ ...
-
bioRxiv - Systems Biology 2023Quote: Approximately 5 mg of frozen prefrontal cortex was homogenized in 1 ml RLT buffer (Qiagen) using a BeadBeater (BioSpec ...
-
bioRxiv - Microbiology 2023Quote: ... The cell pellets were resuspended in 1 ml Qiagen RNA protect reagent (Qiagen, Venlo, Netherlands) and incubated for 24 h at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... 30 min) and supernatant was loaded onto a 1 ml Ni-NTA Superflow column (Qiagen). Proteins were eluted by an increasing imidazole gradient according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lysates were centrifuged at 16,000 g for 5 min and supernatant was treated with 4 µL of RNase A (100 mg/mL) (Qiagen Singapore Pte. Ltd, Cat. No. 19101), gently mixed by flicking of tube and incubated at room temperature for 2 min ...
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: ... each pre-incubated at a 2:1 molar ratio with Penta His Alexa Fluor 647 Conjugate (Qiagen, UK). Hits (duplicate AF647 positive spots ...
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Microbiology 2020Quote: Total RNA extraction was performed using a squash buffer (10 mM Tris base, 1 mM EDTA, 50 mM NaCl) supplemented with 1:8 part Proteinase K (Qiagen, 15mg/ml). Mosquito abdomens with the midguts and heads with thoraces were individually collected in 50 μl of squash buffer at 7 and 14 days ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from cavin1a/1b DKO and WT zebrafish embryos (> 100 embryos randomly selected from 1 clutch) using the RNeasy Mini Kit (QIAGEN) and cDNA synthesis was performed using SuperscriptIII reverse transcriptase (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse tissue disruption and homogenization was performed in RIPA buffer supplemented with 1:100 protease using Tissue Lyser LT (Qiagen), for 5 min at 50 Hz ...
-
bioRxiv - Genetics 2022Quote: Total RNA was isolated from 50 to 100 μl of packed worms from wild type and brd-1(null) using the RNeasy Mini Kit (74104; Qiagen) and QIAshredder (79654 ...
-
bioRxiv - Plant Biology 2023Quote: ... One zirconia ball and 500 μl of 100% methanol premixed with ribitol (20:1) were added and samples were subsequently homogenized in the Tissue Lyser (Qiagen) 3 min at 25 Hz ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted from the remaining 2 mL of the cell suspension using the RNeasy® Protect Bacteria Mini Kit (QIAGEN, Cat. No. 74524) following the manufacturer instructions.
-
bioRxiv - Genomics 2019Quote: ... midi 100/G (Qiagen, Hilden, Germany) with minor alterations including no vigorous mixing steps (performed by inversion ...
-
bioRxiv - Cancer Biology 2023Quote: ... Resuspend the cells in 10 ml of suspension buffer (10 mM EDTA pH8.0, 150 mM NaCl, 1% glycerol, Lysis blue (1×, from QIAGEN Plasmid Plus Midi Kit), RNase A (0.55 mg/ml) ...
-
bioRxiv - Genetics 2021Quote: ... PCR 2 products were purified by electrophoresis with a 1% agarose gel using a QIAquick Gel Extraction Kit (Qiagen) and eluting with 30 μL water ...
-
bioRxiv - Systems Biology 2019Quote: ... ∼20 mg frozen tissue was pulverised in chloroform-methanol (400 µl; 2:1 v/v) using a TissueLyser (Qiagen), then the mixture was sonicated for 10 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins with log fold change >1 and Z-score > 2 were further analyzed in Ingenuity Pathway Analysis (IPA, Qiagen) to determine pathways enriched by the bait proteins ...
-
bioRxiv - Genomics 2022Quote: ... PCR#1 amplicons were selected on a 2% agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen). These amplicons were then used as template for “PCR#2” reactions ...
-
bioRxiv - Physiology 2022Quote: Frozen liver tissue was manually crushed and 30 mg per sample was homogenized in 1mL of 2:1 chloroform:methanol via a TissueLyser II (Qiagen). Samples were stored at 4 °C overnight with agitation ...
-
bioRxiv - Cancer Biology 2019Quote: ... tissue was digested away from the slide by incubating the tissue with 1% 2-mercaptoethanol in RLT buffer (Qiagen) for one hour at 56°C with interval shaking ...
-
bioRxiv - Cancer Biology 2020Quote: ... tissue was digested away from the slide by incubating the tissue with 1% 2-mercaptoethanol in RLT buffer (Qiagen) for one hour at 56°C with interval shaking ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins with log fold change >1 and Z-score > 2 were further analyzed in Ingenuity Pathway Analysis (IPA, Qiagen) to determine pathways enriched by the bait proteins ...
-
bioRxiv - Genomics 2020Quote: ... first strand synthesis was performed by incubating the pucks in 200 μL of reverse transcription solution (Maxima 1x RT Buffer, 1 mM dNTPs, 2 U/μL Lucigen NxGen RNAse inhibitor, 2.5 μM template switch oligo with Qiagen #339414YCO0076714 ...
-
bioRxiv - Genomics 2021Quote: ... Illumina reads for each genome were mapped to the yeast reference genome (R64-2-1, yeastgenome.org) using CLC-Genomics software (Qiagen). Resulting read mapping files were then subjected to copy number and heterozygous single nucleotide polymorphism (hetSNP ...
-
bioRxiv - Genomics 2022Quote: ... Illumina reads for each genome were mapped to the yeast reference genome (R64-2-1, yeastgenome.org) using CLC-Genomics software (Qiagen). Resulting read mapping files were then subjected to copy number and heterozygous single nucleotide polymorphism (hetSNP ...
-
bioRxiv - Immunology 2021Quote: Snap frozen tissue samples or cells were homogenized in 0.5-1 ml Qiazol (Qiagen, Hilden, Germany) using a Retsch Homogenizer (Retsch GmbH ...
-
bioRxiv - Genomics 2019Quote: ... All wells were then pooled and diluted 5:1 (∼24 mL) in Buffer PB (Qiagen #19066) with 1/20th volume of 3 M NaOAc pH 5.2 (∼1.2 mL) ...
-
bioRxiv - Biochemistry 2020Quote: ... The cytosolic supernatant was incubated and stirred with 1 ml Ni-NTA agarose (Qiagen, Hilden, Germany) at 4 °C for 1 h ...