Labshake search
Citations for Qiagen :
751 - 800 of 3538 citations for Monocyclohexyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Systems Biology 2019Quote: ... Approximately ∼50 mg frozen tissue was pulverised in methanol-chloroform (300 µl, 2:1 v/v) using a TissueLyser (Qiagen, West Sussex, UK). Then the mixture was sonicated for 10 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA from untreated or RSL3-treated (with or without 2 hr pre-treatment with 2 µM Ferrostatin-1) MM1S and MM1R cells was extracted using the RNeasy Mini Kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... was extracted from 100 μl of viral suspension complemented with 100 μl of 1x PBS with the QIAamp DNA Mini kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions for DNA purification of total DNA from cultured cells ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from approximately 250 g cecal and 100 g colonic content using the DNeasy PowerLyzer PowerSoil kit (Qiagen, 12855-100), as described previously3 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cleared lysate was applied to a 20 ml disposable gravity-flow column 1.5 ml (0.75 ml bed volume) of NI-NTA agarose (Qiagen cat. #30210), washed twice in three bed volumes of Lysis Buffer ...
-
bioRxiv - Microbiology 2021Quote: ... with QIAGEN-tip 100 (Qiagen, Cat No./ID: 10043) following the manufacturer’s instruction with the following minor modifications ...
-
bioRxiv - Microbiology 2021Quote: ... The Qiagen Genomic Tip (100/G) kit (Qiagen; 10243) was used to extract DNA from 100 mg of tissue powder ...
-
bioRxiv - Genomics 2022Quote: ... and eluted with 100 μl 1X AE Buffer (Qiagen). For enrichment by MDA ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was removed by 100 µg RNaseA (Qiagen, # 19101) treatment at 37°C for 1 hr ...
-
bioRxiv - Microbiology 2019Quote: ... then 100 μl of RNA protect bacteria reagent (Qiagen) was added ...
-
bioRxiv - Microbiology 2020Quote: ... and resuspended to 100 μM in Buffer TE (Qiagen). An undiluted oligo mix for each organism was created by mixing equal volumes of all 16S and 23S primers ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were incubated with 100 µl RNase A (QIAGEN) for 30 min at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA was resuspended in 100 μL volumes PB (Qiagen) and dissolved by incubation at 55°C under vigorous shaking for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... and eluted in 100 μl of Buffer EB (Qiagen). ChIP DNA was quantified by qPCR analysis (Biorad ...
-
bioRxiv - Genomics 2023Quote: ... samples were incubated with 100 μl RNase A (QIAGEN) for 30 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... and eluted in 100 µl buffer EB (Qiagen, #19086) per 5e6 T cells ...
-
bioRxiv - Bioengineering 2023Quote: ... and 100 μl of RLT solution (RNeasy kit, Qiagen) was added to the chip’s well ...
-
bioRxiv - Genomics 2024Quote: ... 100 DNA extractions (Qiagen QIAamp Fast DNA Stool kit) from clinical samples from Prof ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL DNase I and 200 µg/mL RNase A (Qiagen). Followed by a mild sonication (10 strokes ...
-
bioRxiv - Microbiology 2020Quote: ... We immediately transferred all swabs and film to a microcentrifuge tube with 1 mL lysis buffer and garnet homogenization beads (Qiagen NV ...
-
bioRxiv - Microbiology 2020Quote: ... We sampled 1 ml of the clear phase for living planktonic cells and extracted DNA using DNeasy Blood & Tissue Kit (Qiagen). The cultures were also plated on SHIEH-agar plates with dilutions for cfu/ml -estimation and colony-PCR.
-
bioRxiv - Molecular Biology 2019Quote: ... Pellet was treated with 20 μg lysostaphin (1 mg/ml) and RNA isolation was performed using the RNeasy Plus mini kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Kinetochore proteins were conjugated to these beads using antibodies that recognize specific proteins or their tags: biotinylated anti-His-tag antibodies (6 µg ml−1, Qiagen), biotinylated anti-GFP antibodies (20 µg ml−1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The lysate was then centrifuged at 15 000 ×g and the supernatant was added to the 1 mL Ni-NTA resin (Qiagen). After washing with Buffer A supplied with 30 mM imidazole ...
-
bioRxiv - Genomics 2019Quote: ... We washed the pellets with 1 ml 70% ethanol and air dried before resuspending the libraries in EB buffer (Qiagen).
-
bioRxiv - Genetics 2020Quote: Bone marrow was isolated by flushing and red cell lysis performed by resuspending pellet in 1 ml of Buffer EL (Qiagen) and incubating on ice for 15 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... Fluorescence positive cells were collected in a round-bottom polystylene tube that contains 150 - 200 μl RLT buffer with beta-mercaptoethanol (10 μl / 1 ml RLT buffer, RNeasy micro kit protocol, Qiagen). Cell sorting was performed for about 15 min and collected cells were immediately frozen on dry ice and kept in −80 °C for up to one week ...
-
bioRxiv - Microbiology 2020Quote: Samples for RNA-sequencing were crushed in liquid nitrogen using a sterile pestle and mortar on dry ice and resuspended by vortexing in 1 mL RLT Buffer (Qiagen) supplemented with β-mercaptoethanol (10 μl in every 1 ml buffer) ...
-
bioRxiv - Genomics 2020Quote: ... Cells were seeded in 6-well plates at a density of 1×106 cells/mL and transfected with 200 ng of plasmid using the Effectene transfection kit (Qiagen). Cells were harvested following 3 days of incubation.
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from 1 mL digestate slurry or 0.25 g soil using the PowerLyzer™ Soil DNA extraction kit (QIAGEN) following a modified kit protocol where bead beating for 30s at 4.5 ms−1 in a MP Biomedicals™ FastPrep®-24 (Thermo Fischer Scientific Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were washed 3 times with sterile 1x PBS and were then lysed in the plate using 1 mL of RTL buffer from an AllPrep DNA/RNA/Protein isolation kit (Qiagen). Experiments were performed four times.
-
bioRxiv - Physiology 2022Quote: Powdered heart tissues (25 mg) were homogenized in 0.25 mL microtubule stabilization buffer (Supp. Table 1) with a bead mill (Qiagen, TissueLyserII). Homogenates were centrifuged at 1,000×g for 5 mins at 37 ℃ ...
-
bioRxiv - Microbiology 2022Quote: ... cells were lysed in TE buffer (pH=8) supplemented with 1 mg/ml of lysozyme and 10 µl of proteinase K (Qiagen) for 10 minutes at room temperature with a shaking of 500 rpm ...
-
bioRxiv - Microbiology 2022Quote: ... were inoculated in 20 mL tryptone soy broth and incubated at 37°C for 24 h before 1 mL was pelleted and DNA extracted using the DNeasy Blood & Tissue kit (Qiagen). Libraries for genome sequencing were prepared using the NEBNext Ultra DNA Library Prep Kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: ... frozen tissue (hippocampus or cortex) from the left hemisphere were put into 1 ml QIAzol Lysis reagent (Qiagen, Hilden, Germany) and immediately homogenized by a rotor-stator homogenizer (TissueRuptor ...
-
bioRxiv - Cell Biology 2021Quote: ... The extracellular RNAs from 1 mL CPB patient plasma samples were isolated using the exoRNeasy Midi kit (Qiagen, Cat# 77044).
-
bioRxiv - Microbiology 2022Quote: ... loops were taken out from the re-opened cavity and each loop was homogenized in 1 ml sterile PBS using TissueLyser LT (Qiagen) and stainless-steel beed ...
-
bioRxiv - Immunology 2019Quote: Lung tissue from individual mice were homogenized in 1 mL of TRIsure reagent with TissueLyser II (Qiagen, cat. no. 853000) and as per the manufacturer’s instructions and samples were centrifuged for 15 min at 12,000 x g at 4°C to remove cellular debris ...
-
bioRxiv - Genomics 2019Quote: Cells aliquoted for RNA processing were spun down and resuspended in 3.2 mL of RLT (1% ß-Mercaptoethanol) from a Qiagen RNeasy Midi kit (Qiagen). Cells were homogenized by passing the lysate through an 18-gauge needle 10 times and were stored at −80°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA was finally purified by reverse crosslinking at 65°C overnight followed by proteinase K (0.5 or 1 mg/ml, respectively) digestions and purifying with MinElute® PCR purification kit (Qiagen).
-
bioRxiv - Genomics 2020Quote: 3 million cells from cell lines or patient samples were pelleted and resuspended in 1 mL of Cell Lysis Solution (Qiagen) mixed with 500 μg of RNase A ...
-
bioRxiv - Molecular Biology 2020Quote: DNA extraction was done from 1 ml of the different sample types using QIAamp DNA mini kit (Qiagen, Hilden, Germany), as per the vendor’s instructions with slight modifications ...
-
bioRxiv - Microbiology 2020Quote: ... Glass beads (3mm) and 1 mL of sterile water were added for homogenization at 30Hz for 10 minutes (TissueLyser II, Qiagen). Homogenates were diluted with PBS and inoculated onto SAB plates and incubated for 3 days at 30°C ...
-
bioRxiv - Microbiology 2020Quote: ... Preparation of total RNA and Northern blotting including the determination of RNA half-lives were carried out as described previously [29] except that 1 ml time samples were taken and directly added to 250 μl RNAprotect Bacteria Reagent (Qiagen) or to 250 μl containing 5 % phenol and 95 % ethanol ...
-
Glutaric aciduria type 3 is a naturally occurring biochemical trait in inbred mice of 129 substrainsbioRxiv - Biochemistry 2020Quote: ... were homogenized in ice-cold RIPA buffer supplemented with protease inhibitor cocktail (∼20 mg tissue per 1 mL lysis buffer) using a TissueLyser II apparatus (Qiagen) and the homogenates were centrifuged at 1,000xg ...
-
bioRxiv - Cancer Biology 2019Quote: Genomic DNA was extracted from up to 1 mL whole blood or buffy coat using the Gentra Puregene Blood Kit (Qiagen) as per the manufacturer’s protocol ...