Labshake search
Citations for Qiagen :
551 - 600 of 2209 citations for 8 3 5 DIMETHYL 4 METHOXYPHENYL 8 OXOOCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...
-
bioRxiv - Bioengineering 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 μL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Stainless steel 5 mm beads (Qiagen, Germany) were additionally sterilised by heating at 220°C for 3 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5 mm stainless steel beads (Qiagen) at 30 Hz for 3 min at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 mm stainless steel beads (Qiagen) for 4 minutes at 24,000 rpm ...
-
bioRxiv - Genetics 2023Quote: ... 5 ul of 5X Q-solution (Qiagen), 1 ul of 5 mM 7-deaza-dGTP (NEB) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAse A (5 μg/mL, Qiagen #19101) was added to the whole cell extracts (WCE ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.7 × 10−5 AU/mL protease (Qiagen), 1.0 μM barcoded oligodT-ISPCR primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mm diameter stainless steel bead (Qiagen) was added to all the tubes and the tissue was homogenised in TissueLyser II (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and stainless-steel beads (5 mm, Qiagen) before RNA isolation using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... using stainless steel beads (5 mm; Qiagen). RNA was then extracted using a RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: ... using 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3min (Qiagen/Retsch Bead Beater) ...
-
bioRxiv - Neuroscience 2024Quote: ... using 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3min (Qiagen/Retsch Bead Beater) ...
-
bioRxiv - Genomics 2024Quote: ... 5 µL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Genetics 2020Quote: ... AC7594-5’-CCGCCTATCCTCGTCATGAAC)andcontrolALG9primers(AC5067-5’-CACGGATAGTGGCTTTGGTGAACAATTAC;AC5068-5’-TATGATTATCTGGCAGCAGGAAA GAACTTGGG) (0.5 µM) and QuantiTect SYBR Green PCR master mix (Qiagen) on a StepOnePlus Real-Time PCR machine (Applied Biosystems ...
-
bioRxiv - Bioengineering 2024Quote: ... A subset of the samples (5 g) was preserved in 5 mL RNA preservation solution (RNAprotect, QIAGEN, Hilden, Germany) and stored at -80°C ...
-
bioRxiv - Immunology 2021Quote: Cell free DNA was extracted from 850μl serum using the QIAamp Circulating Nucleic Acid Kit (Qiagen) and was quantified by TaqMan Real-time PCR (StepOneTM Plus Real-Time PCR System ...
-
bioRxiv - Biochemistry 2022Quote: ... The soluble fraction was loaded onto a column packed with Ni(II)-nitriloriacetic acid agarose (Qiagen) pre-equilibrated in 100 mL of binding buffer (50 mM potassium phosphate at pH 7.0 ...
-
bioRxiv - Microbiology 2019Quote: ... using the QIAamp Viral RNA Mini Kit or QIAamp Circulating Nucleic Acid kit (Qiagen, Hilden, Germany). Total nucleic acid was eluted in two centrifugation steps with 40 µl of Buffer AVE each ...
-
bioRxiv - Biochemistry 2020Quote: ... The soluble lysate fraction was bound in batch to nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen). The resin was washed extensively with 20 mM Tris ...
-
bioRxiv - Biochemistry 2020Quote: ... The soluble lysate fraction was bound in batch to nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen). The resin was washed extensively with 20 mM Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM PMSF and the resulting supernatant was incubated with nickel-nitrilotriacetic acid agarose (QIAGEN) overnight at 4 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... lysed and incubated with nickel-nitrilotriacetic acid beads as per the manufacturer instructions (Qiagen, Hilden, Germany). Beads were washed ...
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acid was extracted using the Qiagen QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany), substituting carrier RNA with linear polyacrylamide (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acids were isolated from cell lysates or lung homogenates using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The complete amino acid sequences were aligned by the CLC Genomics Workbench software version 11.0.1 (QIAGEN) (default parameters with very accurate ...
-
bioRxiv - Molecular Biology 2020Quote: ... the collected eluate was incubated with pre-washed nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen) for 90 min at 4°C to remove the His-tagged TEV protease ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated from 2OD of cells using acid phenol and purified using RNeasy kit (Qiagen). Reverse transcription was performed on 750ng of RNA using SuperScript III First-Strand Synthesis SuperMix (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: HUVECs were transfected at 60% confluency with 10 nmol/L locked nucleic acid (LNA) GapmeRs (Qiagen) or small interfering RNAs (siRNAs ...
-
bioRxiv - Microbiology 2022Quote: Viral nucleic acid was extracted from the tissue homogenates using QIAamp DNA mini kit (Qiagen, Germany) as per the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was then extracted from human blood plasma using the QIAmp Circulating Nucleic Acids kit (Qiagen), eluted in 60-μl elution buffer (10 mM Tris-Cl ...
-
bioRxiv - Microbiology 2021Quote: ... Total nucleic acid was extracted using the Qiagen QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany), substituting carrier RNA with linear polyacrylamide (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted (MagMAX Total Nucleic Acid Isolation Kit, Life Technologies, Carlsbad, CA using a Qiagen robotic extraction station ...
-
bioRxiv - Cell Biology 2022Quote: ... The clarified lysate was first purified on a Ni–nitrilotriacetic acid (NTA) column (QIAGEN, Valencia, CA). The eluate was further purified on glutathione–Sepharose 4B resin (GE Healthcare ...