Labshake search
Citations for Qiagen :
801 - 850 of 2329 citations for 8 3 5 DIMETHYL 4 METHOXYPHENYL 8 OXOOCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 µl Hot Start Polymerase (Qiagen, 5 U/ µl), 20 ng/µl DNA template (95°C for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... siWDR1 (5’-GGTGGGATTTAGGCAATTATT) and AllStars Negative Control siRNA (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of Taq PCR Master Mix kit (Qiagen), 0.4 μl of each primer (100 pmol/μl ...
-
bioRxiv - Biochemistry 2021Quote: ... A 5 ml Strep-tactin Superflow Plus column (Qiagen) was equilibrated with 50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... with a 5 mm diameter stainless steel bead (Qiagen) for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations ...
-
bioRxiv - Immunology 2021Quote: ... Plates contained 5 µl of TCL lysis buffer (Qiagen) supplemented with 1%β-mercaptoethanol ...
-
bioRxiv - Genomics 2021Quote: ... then 24 mL buffer PB (5:1, Qiagen #19066) and 1.2mL NaOAc were added sequentially ...
-
bioRxiv - Genomics 2021Quote: ... 5 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a 5 mm stainless steel bead (Qiagen #69989) in an RNase-free microcentrifuge tube ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 5 mm stainless steel beads (QIAGEN Cat#69989). To these tubes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 µl SYBR Green Mix (Qiagen N.V., Venlo, Netherlands), and 3 µl nuclease-free water (total volume ...
-
bioRxiv - Physiology 2023Quote: ... and homogenized using 5-mm steel beads (Qiagen #69989) in a bead mill (Qiagen TissueLyser LT) ...
-
bioRxiv - Microbiology 2023Quote: ... 5×105 cells were lysed in RLT buffer (QIAGEN) with 10 μL of β-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2021Quote: ... or miR-200b/200c on the ZC3H11A 3’UTR were obtained from Qiagen. TSBs were resuspended in ddH2O to prepare a 50 µM solution ...
-
bioRxiv - Biochemistry 2021Quote: ... The sample was then loaded onto 3 ml of Ni-NTA resin (Qiagen) by gravity at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... n=3) using the RNeasy Mini kit (Cat. No. 74104, QIAGEN, Hilden, German) and manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... by bead beating (50 Hz for 3 five-minute cycles, TissueLyzer II (Qiagen) with 0.1 mm silica beads) ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated from 3 dpf larvae with the RNeasy mini kit (QIAGEN). A cDNA library was generated from the 3 dpf RNA using the high-capacity cDNA reverse transcription kit (ThermoFisher) ...
-
bioRxiv - Neuroscience 2020Quote: NALCN-siRNA and control-siRNA with modification of 3’-AlexaFluor488 (QIAGEN, Maryland, USA) were dissolved in RNase-free water (NALCN-siRNA ...
-
bioRxiv - Cancer Biology 2020Quote: DNA from ~3×106 cells was extracted with DNeasy Blood&Tissue kit (Qiagen). For SUM159PT/MDA-MB-231 hybrids and MCFDCIS/SUM159PT from lung metastasis CytoSNP-12 v2.1 BeadChip array from Illumina was used and data analyzed with GenomeStudio 2.0 software (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... and 12-days post infection (3 samples/group) using the RNeasy Kit (Qiagen). Samples were processed at the Baylor College of Medicine Genomic and RNA Expression Profiling Core (Houston ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were cleaned of enzymes by adding 3× volume Buffer RLT (Qiagen, 79216) and 1× volume ethanol ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected with pNL4-3 vectors using Attractene Transfection Reagent (QIAGEN, Germany). After 8 hr ...
-
bioRxiv - Microbiology 2020Quote: ... Supernatant was collected on day 3 post transfection and Ni-NTA agarose (Qiagen) was used to purify the protein ...
-
bioRxiv - Microbiology 2020Quote: ... in a 2 mL centrifuge tube for 3 min using a TissueLyzer (Qiagen). The obtained mixture was serially diluted in 5.0 mL sterile phosphate buffer and 150 µL aliquots of 10−4 to 10−7 dilutions were spread onto plates containing a range of media ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we incubated samples with Qiagen Solution C3 (Qiagen DNeasy PowerSoil 12888-100-3) to remove PCR inhibitors ...
-
bioRxiv - Neuroscience 2022Quote: ... n = 3) from patient and control tissues using the RNeasy mini kit (Qiagen) and diluted to a concentration of 10ng/µL ...
-
bioRxiv - Microbiology 2022Quote: ... in microcentrifuge tubes with 3 mm Tungsten Carbide Beads (Qiagen, St. Louis, MO). Supernatants were clarified by centrifugation and frozen at -80ºC until viral titration ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we incubated samples with Qiagen Solution C3 (Qiagen DNeasy PowerSoil 12888-100-3) to remove PCR inhibitors ...
-
bioRxiv - Genetics 2024Quote: ... Insects were homogenized for 3 min at 30 Hz with TissueLyser II (Qiagen), using three 3 mm steel beads (TIS GmbH ...
-
bioRxiv - Microbiology 2024Quote: ... 3 times for 30 s at 30 Hz using Tissue Lyser II (Qiagen). After centrifugation at 2,000 rpm for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... and total RNA was extracted from 3 week-old plants by RNeasy (QIAGEN) or Direct-zol (ZYMO RESEARCH) ...
-
bioRxiv - Microbiology 2023Quote: ... Digested protein was mixed with 3 ml of NTA super-flow resin (Qiagen) that had been pre-equilibrated in wash buffer ...
-
bioRxiv - Biophysics 2023Quote: The library preparation was done using the QIAseq UPX 3’ Transcriptome Kit (QIAGEN). A total of 10ng purified RNA was converted into cDNA NGS libraries ...
-
bioRxiv - Genetics 2022Quote: ... 10 μg dsRNA were transfected into 3×106 Drosophila cells using Effectene (QIAGEN).
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted from Calu-3 cells with RNeasy mini kit (Qiagen). Extracted RNA was quantified and purity was verified by Nanodrop 2000 spectrophotometer (ThermoFisher) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleared and filtered supernatants were applied to 3 mL Ni-NTA Agarose (QIAGEN) equilibrated in buffer B (20 mM HEPES/KOH pH 7.8 ...
-
bioRxiv - Plant Biology 2023Quote: ... Tissue was ground with 3 mm stainless steel beads in a TissueLyser (Qiagen) with intensity of 30 for 1 min ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Genomics 2024Quote: ... Results were analysed with the PyroMark Q24 software (version 2.0.8, build 3, Qiagen). DNA methylation values obtained via pyrosequencing were compared between the HS and Control groups using a Wilcoxon test.
-
bioRxiv - Systems Biology 2020Quote: ... the MoBioPowersoil 96 kit (now Qiagen Cat No./Id: 12955-4) was used with minor modifications ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL of Buffer D2 (REPLI-g Single Cell Kit, Qiagen) and 1 μL of 500 μM exonuclease-resistant random primer were then added to the lysed cells to denature the DNA prior to vortexing ...
-
bioRxiv - Cell Biology 2022Quote: ... and TBT (4 biological replicates per condition) with RNeasy columns (Qiagen), followed by oligo-dT selection ...
-
bioRxiv - Systems Biology 2023Quote: ... or 4 pmol total negative control siRNA (Allstars negative control, Qiagen), were transfected using the Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated on 4-12% Bis-Tris gels (Novex, Qiagen) using MOPS running buffer (Novex ...
-
bioRxiv - Biophysics 2021Quote: cfDNA was isolated from 2 mL of plasma for each sample via the QIAamp Circulating Nucleic Acid kit (Qiagen). ddPCR was performed using the QX200 Droplet Digital PCR System (Bio-Rad) ...
-
bioRxiv - Biochemistry 2019Quote: ... and the supernatant was subjected into 9+ 9_ļ_ Ni2+ -nitrilotriacetic acid (Ni2+ -NTA) agarose resin (Qiagen, Valencia, CA, USA) for affinity chromatography purification ...
-
bioRxiv - Biochemistry 2019Quote: ... Acid-phenol based method was used to isolate total RNA and then purified using RNAeasy mini kit (Qiagen,USA) after a DNAse treatment (TURBO™ DNase ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...