Labshake search
Citations for Qiagen :
351 - 400 of 2209 citations for 8 3 5 DIMETHYL 4 METHOXYPHENYL 8 OXOOCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... but were purified using nickel-nitrilotriacetic acid resin (Qiagen, Germantown, MD). The final protein concentration was 15-260 μM (~2-10 mol ADP per mol kinesin) ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were purified using nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen) and the histidine tag was subsequently removed by thrombin digestion (10 U/mg of protein) ...
-
bioRxiv - Neuroscience 2022Quote: Locked Nucleic Acid (LNA) oligonucleotides for C21orf2 were purchased from Qiagen. A complete list of the used ASOs can be found in extended data table 6 ...
-
bioRxiv - Microbiology 2020Quote: ... The proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA; Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... which were purified by adsorption to nitrilotriacetic acid (NTA) agarose (QIAGEN) and elution with 25 mM NaH2PO4-150 mM NaCl-125 mM imidazole buffer (pH 8.0 ...
-
bioRxiv - Genomics 2021Quote: ... These kits included QIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany), Plasma/Serum Cell-Free Circulating DNA Purification Mini Kit (Norgen Biotek ...
-
bioRxiv - Cell Biology 2020Quote: ... lysed and incubated with nickel-nitrilotriacetic acid beads (Qiagen, Hilden, Germany) as per the manufacturer instructions ...
-
bioRxiv - Genomics 2020Quote: cfDNA was extracted using the QIAamp Circulating Nucleic Acid kit (Qiagen). Isolation of cfDNA was done from 1 mL of plasma ...
-
bioRxiv - Microbiology 2023Quote: ... The eluted nucleic acid was purified using the DNeasy Kit (Qiagen) and analyzed with RT-PCR strong stop primers (SSS ...
-
bioRxiv - Microbiology 2023Quote: ... The eluted nucleic acid was purified using the DNeasy Kit (Qiagen) and analyzed by qPCR with strong-stop primers (primers PR and PU5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (QIAGEN, cat # 30230) and the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified with Ni2+-nitrilotriacetic acid agarose beads (Qiagen) and desalted with Bio-Gel P-6DG gel (Bio-Rad) ...
-
bioRxiv - Genomics 2024Quote: ... Nucleic acid isolation was performed using the QIAcube (Qiagen, Hilden, Germany) and the PAXgene blood miRNA kit according to the manufacturer’s protocol to extract gene-encoding mRNAs ...
-
bioRxiv - Cancer Biology 2024Quote: ... and rEDA was purified using nickel-nitrilotriacetic acid-agarose resin (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... 5-plex (Qiagen, Germany), the QIAcuity One-Step Viral RT-PCR Kit (Cat No ...
-
bioRxiv - Cell Biology 2020Quote: ... + 5 μM TSO (Qiagen). Amplification of cDNA (22 amplification cycles ...
-
bioRxiv - Molecular Biology 2021Quote: Ni-NTA agarose beads (Qiagen 70666-3)
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5×10^5 EpCAM+ve cells were lysed in 350μL RTL Buffer (Qiagen) containing 143mM β-Mercaptoethanol (aided by cell searing via passage ...
-
bioRxiv - Microbiology 2020Quote: Nucleic acids were extracted using the AllPrep DNA/RNA Micro kit (Qiagen) for simultaneous purification of minute amounts of DNA and RNA from the same sample without making use of the carrier RNA ...
-
bioRxiv - Microbiology 2019Quote: Nucleic acid extraction was performed with Advanced XL EZ1 (Qiagen, Hilden, Germany). The digestion step using proteinase K was performed for 10 minutes at 56 °C and 10 minutes at 95 °C followed by purification with EZ1 Tissue card according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Total nucleic acid was extracted with QIAcube HT system (Qiagen, Valencia, Calif.), according to the manufacturer’s instructions for tissue or insects ...
-
bioRxiv - Cell Biology 2020Quote: ... the resulting supernatant was incubated with nickel-nitrilotriacetic acid agarose beads (QIAGEN) pre-equilibrated with the washing buffer (20 mM HEPES ...
-
bioRxiv - Biochemistry 2021Quote: ... Cleared lysate was incubated with Ni-nitrilotriacetic acid (NTA) resin from Qiagen for 1hr at RT ...
-
bioRxiv - Zoology 2021Quote: Nucleic acids were extracted using a QIAamp MinElute Virus Spin Kit (QIAGEN) and used to construct the sequencing libraries ...
-
bioRxiv - Microbiology 2020Quote: ... then the nucleic acid was purified using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Viral ribonucleic acid (RNA) was extracted by viral RNA kit (Qiagen, Germany), reversed by reverse transcription kit (Promega ...
-
bioRxiv - Biochemistry 2022Quote: ... Ni(II)-nitrilotriacetic acid agarose (Ni-NTA) resin was purchased from Qiagen. L-Allylglycine was purchased from Cayman Chemical Company ...
-
bioRxiv - Molecular Biology 2022Quote: ... the His-SUMO conjugates were enriched using nickel-nitrilotriacetic acid beads (Qiagen). Upon multiple washing steps ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 µL of dry nickel-nitrilotriacetic acid-agarose (Ni-NTA) beads (QIAGEN), were equilibrated with Guanidinium buffer supplemented with 5 mM β-mercaptoethanol and 50 mM Imidazole pH 8.0 ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by purification using nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (QIAGEN). The recombinant protein was desalted with PD-10 column (SephadexTM G-25M ...
-
bioRxiv - Genomics 2019Quote: ... Plasma DNA was extracted using the QiaAmp Circulating Nucleic Acids kit (Qiagen). DNA was extracted from FFPE ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 1 μM Locked Nucleic Acid (LNA) oligo-d(T)30 (Qiagen) in primary-probe hybridization buffer composed of 40% formamide (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted with the QIAamp Viral RNA mini kit (QIAGEN) to be further randomly amplified using a modified Whole Transcriptome Amplification 2 (WTA2 ...
-
bioRxiv - Microbiology 2021Quote: ... the supernatant was extracted with a nickel-nitrilotriacetic acid-agarose suspension (Qiagen) or a Pierce GST Spin Purification Kit (Thermo ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 μL of dry nickel-nitrilotriacetic acid-agarose (Ni-NTA) beads (QIAGEN), were equilibrated with Guanidinium buffer supplemented with 5 mM β-mercaptoethanol and 50 mM Imidazole pH 8.0 ...
-
bioRxiv - Biophysics 2023Quote: ... GlpG in supernatant was purified using nickel-nitrilotriacetic acid (Ni-NTA, Qiagen) affinity chromatography in 50 mM Tris-HCl buffer (pH 8.0 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted using nucleic acid isolation kit (AllPrep® Qiagen) according to protocol instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant proteins were purified over nickel-nitrilotriacetic acid (Ni-NTA) Agarose (Qiagen). Therefore ...
-
bioRxiv - Biochemistry 2023Quote: ... the clarified supernatant was incubated with nickel-nitrilotriacetic acid agarose resin (QIAGEN) for 3 hours at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Monovalent IgG was further purified by Ni- nitrilotriacetic acid (Ni-NTA) (Qiagen) column and then size exclusion column (superdex 200 ...
-
bioRxiv - Biochemistry 2023Quote: ... for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins (2 hr ...
-
bioRxiv - Bioengineering 2024Quote: ... the supernatant was incubated with Ni-nitrilotriacetic acid (NTA) agarose resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... Nickel-nitrilotriacetic acid (Ni-NTA) resin was obtained from Qiagen (Valencia, CA). Stain free gels (4-12% ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...