Labshake search
Citations for Qiagen :
451 - 500 of 3263 citations for 2 3 5 Dioxo 4 aza tricyclo 5.2.1.0*2 6* dec 8 en 4 yl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... After diluting samples in a 4:1 ratio (elution buffer [Qiagen]:cDNA), cDNA concentration was determined using a Bioanalyzer (Agilent Technologies).
-
bioRxiv - Biochemistry 2020Quote: ... Crystallization screening was performed at 4°C with JCSG core I (Qiagen) using the sitting drop vapor diffusion method ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μl of DNA) and run in Rotor-Gene Q machine (Qiagen). Primer sequences are listed in the Table 2 ...
-
bioRxiv - Microbiology 2021Quote: ... Removed culture was mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) for stabilization and incubated for 5 min at room temperature before centrifugation at 4000 rpm for 10 min ...
-
bioRxiv - Microbiology 2023Quote: ... The siRNAs were selected from the FlexiTube GeneSolution 4 siRNA sets (Qiagen) and transfected as a mix at 24 nM in Calu-3 and 10 nM in Caco-2 following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... At least 4 colonies were used for each DNA miniprep (QIAprep, Qiagen) and mutations were confirmed by Sanger sequencing (Source Bioscience) ...
-
bioRxiv - Neuroscience 2023Quote: ... at a frequency of 28/s @ 4°C (Tissue Lyser II, Qiagen). After this step the samples were adjusted to RT for 5 minutes and processed using the RNeasy Lipid Tissue Mini Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... HL-1 cells were transduced with a pool of 4 gapmers (Qiagen) at 40nM (10Nm each ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7.5 at 4°C) and purified using the RNAeasy kit (Qiagen).
-
bioRxiv - Microbiology 2022Quote: ... with 4 × 108 copies of cel-miR-39 miRNA mimic (Qiagen 339390) spiked into to the sample after addition of lysis buffer.
-
bioRxiv - Immunology 2024Quote: ... and 4 weeks post-transduction using the DNeasy Blood & Tissue kit (Qiagen). Genomic DNA was also extracted from HEK293T cells used for lentiviral production to confirm baseline sgRNA frequencies ...
-
bioRxiv - Cancer Biology 2024Quote: ... TagLuc non-expressing clone 4 cells using the RNeasy Mini Kit (Qiagen). 1 μg was reverse-transcribed using an oligo-dT primer and ProtoScript II Reverse Transcriptase (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genomics 2024Quote: ... RNA was first amplified using a first-round PCR (RdRp S1 5ߣ-GGKTGGGAYTAYCCKAARTG -3’, RdRp R1 5’-TGYTGTSWRCARAAYTCRTG-3’) with the One-Step RT-PCR Enzyme MixKit (Qiagen), targeting a total expected size of 620 base pairs (bp) ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from CD3+ T-cells using the Qiagen RNeasy Plus Mini Kit or EN AllPrep Mini Kit with on column DNaseI (Qiagen) digestion ...
-
bioRxiv - Cancer Biology 2024Quote: Après avoir réalisé les collections de fractions en sortie de SdFFF RNA extraction and RTqPCR analysis were extracted using the RNeasy Mini Kit (QIAGEN) and quantifed by NanoDrop 2000 (Termo Fischer) ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 5 or 6 Transwells using the RNeasy Micro Plus kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...
-
bioRxiv - Bioengineering 2023Quote: ... DNA was extracted in pools of 6-8 adult mosquitoes mosquitoes using Blood & Cell Culture DNA Midi Kit (Qiagen, Cat# 13343) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM PMSF) on a Ni-NTA resin (Qiagen). Bound proteins were washed (50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) containing 0.1% Tween20 (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... the 2 proteases of proteinase K (Qiagen, Hilden, Germany) and dispaseII (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µl Qiagen CL buffer (10x; Qiagen, Hilden, Germany), 0.4 µl MgCl2 (25 mM ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) are added to one volume of bacterial culture ...
-
bioRxiv - Genomics 2022Quote: ... 2 μl of 100 mg/mL RNase A (Qiagen) was added and the tubes were incubated at 37°C for 15 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... [2] or QIAzol® Lysis reagent (Qiagen, #cat 79306) following vendor’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... and 16.7% (v:v) Proteinase K (Qiagen, 19131, 2 mL). The suspension was then incubated at 37 ℃ for 15 minutes at 500 r.p.m.
-
bioRxiv - Microbiology 2024Quote: ... packed with 2 mL Ni-NTA agarose resin (Qiagen) pre-equilibrated with 15 mL lysis buffer ...
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL Ni-NTA resin (Qiagen, Cat. # 30210) was equilibrated with 10 mL of 1X Base buffer and 5 mM β-mercaptoethanol for 10 min by constantly rotating ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sample incubated with 2 NiNTA resin (Qiagen, USA). Protein samples were allowed to bind for 4 hr ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Clarified lysate was mixed with Ni-NTA agarose at 4℃ for 2h (Qiagen). Bound protein was eluted in 20 mM Tris pH 8.0 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lysates were treated with 4 μl of 100 mg/ml RNase A (QIAGEN) at 37 °C shaking at 500 RPM for 3 hours ...
-
bioRxiv - Immunology 2021Quote: ... and kept at 4°C RNA was purified using RNEASY Mini Kit (Qiagen) and its concentration determined using a Nanodrop 1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... 4°C for 10 min and the pellet was lysed with RLT+ (Qiagen). For scRNA-sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... at 4°C until RNA was extracted using the RNeasy Mini Kit (Qiagen)
-
bioRxiv - Microbiology 2020Quote: The MoBio PowerSoil-htp 96 kit (now Qiagen Cat No./Id: 12955-4), with minor modifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... cell pellets were lysed in a 4% SDS buffer using a Qiashredder (Qiagen). Relative densitometry for western blots was determined using ImageJ software and normalized to the density of loading control β-ACTIN ...
-
bioRxiv - Microbiology 2021Quote: ... into a volume of 4 μL PBS sc 1X (Qiagen, Cat. No. 150345). To avoid evaporation of the PBS sc 1X during the sort ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL of room temperature Stop solution (REPLI-g Single Cell Kit, Qiagen) was then added and the samples were vortexed and spun down ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with dsHsc70-4 with the Effectene Transfection reagent (301427, QIAGEN) and incubated for 72 h ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was incubated overnight at 4 °C with Strep-Tactin Beads (Qiagen), typically using 0.75 ml packed beads per two liters of original culture volume ...
-
bioRxiv - Microbiology 2023Quote: ... supernatant was incubated overnight at 4°C with Ni-NTA agarose beads (Qiagen) used to purify the recombinant proteins as described [40] ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 18 µl of Omniscript enzyme at 4 U/µl (Omniscript RT Kit, Qiagen), and 37 µl water ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Crystals were grown at 4 °C in EasyXtal-15-Well Tools plates (Qiagen), using hanging-drop vapour diffusion ...