Labshake search
Citations for Qiagen :
351 - 400 of 3263 citations for 2 3 5 Dioxo 4 aza tricyclo 5.2.1.0*2 6* dec 8 en 4 yl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... RNA from each Xenopus embryo (n=2-3/condition) was separately extracted and purified using the RNeasy Micro Kit (Qiagen; Venlo, Netherlands) and microarray measurements were performed using the GeneChip Xenopus laevis Genome 2.0 Array (Affymetrix ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... Collected tissue was ground to a fine powder at -80°C using 3 mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA), and between 10-15 mg of ground tissue per sample was used for auxin extraction ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we homogenized 2-3 fecal pellets in 1 mL H2O using ceramic beads (NucleoSpin, Macherey–Nagel, Dueren, Germany) and a TissueLyser (Qiagen, Hilden, Germany), mixing the sample for 3 × 30 s at 4,500 rpm with a 10 s cooling break (< 0°C) ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Pathology 2021Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen 741-4) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... and WNT signaling targets PCR array (Qiagen, PAMM 243ZE-4) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo) ...
-
bioRxiv - Microbiology 2020Quote: ... 4) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) by the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subsequently normalized to 4 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl Proteinase K (Qiagen, RP107B-1) and 5 µl water was added to each tube with 5 µl sub-library for a final volume of 20 µl per reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Neuroscience 2024Quote: ... and the mouse hippocampal tissues (n=5-6/group; Qiagen, Germantown, MD, USA). The samples of the RNA (500ng/µL ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 M urea [pH 8.0]) and His-tagged Tax proteins were precipitated with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen). After washing in buffer C (100 mM NaH2PO4 ...
-
bioRxiv - Genomics 2022Quote: The second lobe of lung or trachea was immersed in 1 mL PBS in a 2 mL Micro Centrifuge Tube (Fisherbrand, 14-666-315) containing one stainless steel bead (5 mm, QIAGEN, 1026563) immediately after dissecting the SARS-CoV-2 infected mouse or hamster ...
-
bioRxiv - Microbiology 2020Quote: ... and then with (2) 15 µl Proteinase K [>600 mA/ml] and 5 µl Rnase A [100 mg/ml] (Qiagen, Germany) for 5min at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... posterior eye cups (PECs) were separated and collected in 2 mL reinforced tubes (SPEX Sample Prep) containing 5 mM stainless steel beads (Qiagen, LLC).
-
bioRxiv - Evolutionary Biology 2023Quote: Tissue pools were homogenised for 2 min at 30 Hz using 5 mm steel beads on a TissueLyser II instrument (Qiagen, Germany). A volume of 0.2× chloroform (Carl Roth ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Genomics 2024Quote: ... Then the total volume was spun down and plasmid pools were extracted from the bacterial pellets using 2-3 columns of the Hi-Speed Plasmid Maxiprep kit (Qiagen, catalog no. 12663) per sublibrary ...
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Microbiology 2020Quote: ... CjNC110-LNA DIG-labeled probe (/5’DigN/ GCACATCAGTTTCAT/3’Dig_N/) (QIAGEN) was added to 15 mL DIG EasyHyb™ Buffer (Roche ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 μl of proteinase K (approximately 3 U, Qiagen, cat. # 19131) were added and incubated for 1 h at 56°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen, #1027281). After 72 h ...
-
bioRxiv - Cell Biology 2023Quote: ... using 30 nM Hs_LUZP1 siRNA (target sequence, 5′-CAGCGGGTGCTGAGAATTGAA-3′; QIAGEN) or 30 nM AllStars negative-control siRNA (QIAGEN) ...
-
bioRxiv - Cell Biology 2024Quote: ... HOXD11 (Qiagen, Sequence: 5′-TGC TAG CGA AGT CAG A-3′), HOXD13 (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: ... HOXD13 (Qiagen, Sequence: 5′-CAT CAG GAG ACA GTA T-3′), for 24hr and 48hr for RNA and protein extraction respectively ...
-
bioRxiv - Microbiology 2020Quote: ... The 6 × his-tagged proteins were purified using a nickel-nitrilotriacetic acid (Ni-NTA) agarose matrix (30250, Qiagen). Cell-free extracts were loaded on 0.5 ml Ni-NTA matrixes and incubated on a roller shaker for 2 h at 4 °C ...
-
bioRxiv - Genomics 2020Quote: ... purified nucleic acids were treated with 1-5 μl 1 mg/ml RNaseA (Qiagen) for 45 minutes at 37 °C to degrade RNA ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was applied to a 5 ml nickel-nitrilotriacetic acid column (Qiagen, Valencia, CA) that had been equilibrated with buffer A at a rate of 1 ml/min ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lysates were centrifuged at 16,000 g for 5 min and supernatant was treated with 4 µL of RNase A (100 mg/mL) (Qiagen Singapore Pte. Ltd, Cat. No. 19101), gently mixed by flicking of tube and incubated at room temperature for 2 min ...
-
bioRxiv - Genomics 2022Quote: An aliquot of 150 μL of plasma per sample was thawed on ice and centrifuged at 3000 × g for 5 min at 4 °C and smallRNA was extracted using miRNeasy Serum/Plasma Kits (Qiagen, Cat. No. 217184, Milano, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... the MoBioPowersoil 96 kit (now Qiagen Cat No./Id: 12955-4) was used with minor modifications ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL of Buffer D2 (REPLI-g Single Cell Kit, Qiagen) and 1 μL of 500 μM exonuclease-resistant random primer were then added to the lysed cells to denature the DNA prior to vortexing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated on 4-12% Bis-Tris gels (Novex, Qiagen) using MOPS running buffer (Novex ...
-
bioRxiv - Cell Biology 2022Quote: ... and TBT (4 biological replicates per condition) with RNeasy columns (Qiagen), followed by oligo-dT selection ...
-
bioRxiv - Molecular Biology 2024Quote: ... the MagAttract PowerMicrobiome DNA/RNA extraction kit (Qiagen 27500-4-EP) and for 16 samples ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...