Labshake search
Citations for Qiagen :
651 - 700 of 3263 citations for 2 3 5 Dioxo 4 aza tricyclo 5.2.1.0*2 6* dec 8 en 4 yl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: Total mRNA was isolated from 6 hpf to 5 dpf zebrafish homogenates using an RNeasy Mini Kit (Qiagen, 74106) and reverse-transcribed with iScript (Bio Rad ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Neuroscience 2020Quote: ... 6b and 6d and the Supplemental Figure 4 we used the RNAeasy Minikit (Qiagen; Cat#74104) following the manufacturer’s instruction.
-
bioRxiv - Cancer Biology 2020Quote: ... then spun at 14000K RPM for 10 minutes at 4°C to pellet debris (Qiagen, 37901). Protein concentration in the supernatant was quantified using BCA assay (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of 4 μg pBABE-hygro-hTERT prepared by maxiprep (Qiagen Canada, Mississauga, ON), to a final volume of 200 μl ...
-
bioRxiv - Bioengineering 2020Quote: ... Each well is then diluted with 1 to 4 v:v in RNAse free elution buffer (QIAgen) to a total volume of 8 µL ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... the rest of the embryo was fixed in 4% paraformaldehyde/PBS and stained with DAPI (Qiagen) for easy visualization of the somites under a microscope and characterization of the embryonic stage ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...
-
bioRxiv - Plant Biology 2024Quote: ... DNA extractions were performed with the MagAttract PowerSoil DNA kit (Qiagen, Cat. No. 27000-4-KF) optimized for the KingFisher™ Flex Purification System (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Microbiology 2024Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) or the E.Z.N.A Total RNA kit I (Omega-Biotek) ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from 4-day-old Arabidopsis seedlings using RNeasy Plant Mini Kit (Qiagen). For cDNA synthesis ...
-
bioRxiv - Biochemistry 2024Quote: ... for 4 h at 37 °C and purified with PCR purification kit (QIAGEN, catalog no. 28106) per 20 μL IVT reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... genomic DNA was extracted from 4×107 cells using a Puregene Cell Kit (Qiagen Cat#158043). Lentiviral sgRNA inserts were amplified in a two-step PCR using the primers detailed in Supplementary Table 6 ...
-
bioRxiv - Genetics 2024Quote: ... eluted in 4 µl of scPBS and processed following the REPLI-g SC kit (Qiagen, Germany) manufacturer’s guidelines with an incubation time of 2h ...
-
bioRxiv - Cell Biology 2024Quote: RNA at the defined stages of differentiation (day 0, 1, 5, 8, 11, 14, 17, 27, 35, 50) was extracted using RNeasy Plus mini kit (Qiagen, 74136) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Biophysics 2021Quote: ... Capture probes that contained locked nucleic acid (LNA) residues were purchased either from IDT with a 5′ Cy3 modification and HPLC purification or from Qiagen with a 5′ amino modification with HPLC purification ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was then purified by mixing with beads at a 1:0.6 DNA/beads ratio followed by 3 washes with 70% ethanol and eluted with 30 μl of elution buffer (Qiagen Cat# 19086). Whole-exome sequencing was performed using the Mouse_Exome_Targets baitset from the Wellcome Sanger Institute pipeline ...
-
bioRxiv - Neuroscience 2021Quote: ... matching a sequence in intron 22 of the HTT gene (5’-TAATACGTAAGTGTCACAA-3’, custom synthesized by Qiagen) was delivered by intracerebroventricular (ICV ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... cells pooled from n = 3 - 5 mice / cohort) was isolated using the RNeasy Plus Mini Kit (Qiagen). Clariom S microarray analysis (Affymetrix ...
-
bioRxiv - Bioengineering 2024Quote: ... Tsg101 (Hs_TSG101_6) target sequence: 5′-CAG TTT ATC ATT CAA GTG TAA -3′ (QIAGEN, cat. no. SI02655184); Alix (Hs_PDCD6IP_5 ...
-
bioRxiv - Bioengineering 2024Quote: ... Alix (Hs_PDCD6IP_5) target sequence: 5′-AAG AGC TGT GTG TTG TTC AAT -3′ (QIAGEN, cat. no. SI02655345); Negative Control siRNA ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... Each sample was mixed with 5 µL of one of 6 Illumina adapter sequences (specified in the Qiagen protocol appendix) and 2 µL of ultralow input ligase ...
-
bioRxiv - Bioengineering 2020Quote: ... with 1% 2-Mercaptoethanol (Serva) and disrupted using the Qiagen Tissue Ruptor (Qiagen). Total RNA was extracted using the RNeasy Fibrous Tissue Mini Kit (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: ... bron-1 and bron-2 root tips using the RNeasy Micro Kit (Qiagen). qPCR was performed with SYBR green (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... The cell lysate was applied on 2 ml of Ni-NTA agarose (QIAGEN) equilibrated with Buffer A ...
-
bioRxiv - Microbiology 2020Quote: ... Soluble ACE 2 was purified using Nickel -NTA agarose beads (Qiagen Cat.No-1018244), eluted with 200mM imidazole ...
-
bioRxiv - Plant Biology 2020Quote: ... The extracted DNA was eluted in 2 x 100 μL EB buffer (Qiagen), cleaned and concentrated with the Clean and Concentrator-5 kit (Zymo Research ...
-
bioRxiv - Biochemistry 2020Quote: ... coli and purified using Qiagen Ni+2 agarose as per vendor protocol (Qiagen). Recombinant proteins were dialyzed in demethylation buffer overnight at 4°C prior to use in enzymatic assays.
-
bioRxiv - Microbiology 2020Quote: 2 □ 107 spores were mixed with 1 ml RNAlater RNA stabilization reagent (Qiagen) and centrifuged at 17,000 g for 5 min ...
-
bioRxiv - Bioengineering 2022Quote: ... submerged for 2 hours in PaxGene fixation reagent at room temperature (Qiagen #765312), kept overnight at 4°C in PaxGene stabilization reagent ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 2 × 106 cells using QIAzol Lysis Reagent (Qiagen) and cDNA was generated from 0.5 μg of RNA with random hexamers using the GoScript kit (Promega ...
-
bioRxiv - Pathology 2021Quote: Saos-2 cells RNA was extracted using RNeasy mini kit (Qiagen, Catalog#:74104). and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen ...