Labshake search
Citations for Mirus Bio :
351 - 400 of 529 citations for WD Repeat Containing Planar Cell Polarity Effector WDPCP Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... HEK 293 cells were transfected with YF-NS1-GFP using TransIT®-LT1 transfection reagent (Mirus Bio LLC, Belgium), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... adherent Sf21 cells were transfected with plasmids expressing ARIF-1 using TransIT-Insect transfection reagent (Mirus Bio, Madison, WI). At 3 d post-transfection ...
-
bioRxiv - Immunology 2021Quote: ... The obtained recombinant vector was transfected into CHO-S cells using CHOgro High Yield Expression System (Mirus Bio, USA). The culture supernatant containing the RBD protein was harvested after 10 days ...
-
bioRxiv - Immunology 2022Quote: Viral particles were produced by transfection of HEK293FT cells in 6-well plates with 3μg DNA and 8μL TransIT-293 (Mirus Bio) per well ...
-
bioRxiv - Cancer Biology 2021Quote: ... pCMV-deltaR8.91 and pMD2.G-VSV-G into HEK293T cells using the TransIT-LT1 Transfection Reagent (Mirus Bio LLC). Virus-containing supernatants were collected 48 hr after transfection ...
-
bioRxiv - Immunology 2021Quote: ... Retroviral particles were produced by transfection of Platinum E (PLAT-E) cells with the TransIT-LT1 transfection reagent (Mirus) in Opti-MEM I reduced serum medium ...
-
bioRxiv - Immunology 2020Quote: ... Bare mRNA encoding CH505 M5 gp160 Envs were transfected at 0.5 μg/million cells using TransIT-mRNA Transfection Kit (Mirus). Transfected cells were harvested 48 hr post transfection ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were transfected with the N-terminal FLAG-tagged CDC42 expression vector using TransIT 293 (Mirus Bio LLC) in 6-well culture plates ...
-
bioRxiv - Zoology 2022Quote: ... Four µg of either plasmid were transfected into 6 × 105 C6/36 cells using TransIT-2020 transfection reagent (Mirus) for 4 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... were packaged in HEK 293T cells as previously described [15] using Turbofect (Fisher, UK) or trans-IT (Mirus. USA) as lipofection reagents ...
-
Ribosomal quality control factors inhibit repeat-associated non-AUG translation from GC-rich repeatsbioRxiv - Molecular Biology 2023Quote: ... T7 synthesized mRNA was transfected in cells at 70-80% confluency with TransIT-mRNA Transfection Kit (Mirus, MIR 2256) following the manufacturer’s recommended protocol ...
-
bioRxiv - Cell Biology 2022Quote: pQCXIH-SARS-CoV-1-ORF7a-FLAG and pQCXIH-SARS-CoV-2-ORF7a-FLAG were transfected to HEK293T cells with the packaging plasmids pMD.GagPol and pMD.VSVG using Trans-IT293 (Mirus Bio). Viral supernatants were collected 48 hours after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral cell lines were selected with hygromycin (Thermo 10687010, 250 μg/mL) and puromycin (Mirus MIR5940, 10 μg/mL). CT or HLH* EIF3A was cloned into nLV103-hygro ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK cells were transfected with TCR expression vector and lentiviral transfer plasmids using TransIT-VirusGen Transfection Reagent (Mirus #MIR6700) following the manufacturer’s recommendation ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 ng of dCasMINI constructs and 250 ng of sgRNA constructs were transfected to the reporter cell line using 2.5 uL of TransIT-LT1 (Mirus) in 100 ul of Opti-MEM reduced serum media (Thermo Fisher).
-
bioRxiv - Cancer Biology 2023Quote: ... Control and BCAT1-KO U251 cells were reverse-transfected with 1µg/ml of TC3-R9P-3NLS pDNA using 1:2 of Trans-iT (Mirus). 48h after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... plasmids were transfected in duplicate into HEK293T cells in a 48-well plate using LT-1 transfection reagent (Mirus) with the indicated plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... and gRNA plasmids for targeting PRKAA1 and PRKAA2 were co-transfected into cells with TransIT-LT1 (Mirus, MIR 2305) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and the plasmid was transfected into the cells expressing tagged AP1G1 using a TransIT-HeLaMONSTER kit (Mirus Bio LLC), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Viral stocks of NL43 were produced by transfection of HEK293 cells with the molecular clone plasmid using TransIT-LT1 (Mirus) transfection reagent ...
-
bioRxiv - Physiology 2022Quote: ... cells were transfected with 25mM EP300 siRNA or scramble control siRNA via the TransIT-X2 Dynamic Delivery System (Mirus Bio), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells in 6 well plates were transfected with 500 ng/well of each protein-coding plasmid by using TransIT (Mirus). After 48 h ...
-
bioRxiv - Microbiology 2019Quote: ... NL4-3 and NL4-3(AD8) HIV viral stocks were produced by transfection of HEK293 cells with the molecular clone plasmids using TransIT-LT1 (Mirus) transfection reagent ...
-
bioRxiv - Microbiology 2019Quote: ... MHV68 was produced by first making p0 virus by transfecting NIH 3T3 cells in 6-well plates with 2.5 μg BAC DNA using TransIT-X2 (Mirus Bio) for 24h ...
-
bioRxiv - Microbiology 2019Quote: ... 100ng of RIG-I agonist derived from the 3’-UTR of hepatitis C virus (55) was transfected per 1e6 cells using TransIT-mRNA transfection kit (Mirus). For stimulation of MDA5 signaling ...
-
bioRxiv - Biochemistry 2021Quote: ... lentiviral particles were generated by transient transfection of the lentiviral packaging Lenti-X 293T cells (Takahara) with the TCR encoding plasmids and packaging plasmids (VSVg and PSPAX2) 25 using Transit LT-1 (Mirus). Lentiviral supernatant was harvested 2 days later ...
-
bioRxiv - Neuroscience 2020Quote: ... HEK293T cells were maintained in DMEM supplemented with FBS and penicillin/streptomycin and transfected using TransIT-LT1 (Mirus Bio. LLC) with the plasmid containing the sequence of NL-1 or CD4 and incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... In vitro transcribed full-length CHIKV mRNA and mRNA encoding single viral proteins was transfected into target cells with the TransIT mRNA kit (Mirus). MAYV (strain TRVL15537 ...
-
bioRxiv - Neuroscience 2021Quote: TDP-43 inducible knockdown SH-SY5Y cells were electroporated with 2 μg of DNA with the Ingenio electroporation kit (Mirus) using the A-023 setting on an Amaxa II nucleofector (Lonza) ...
-
bioRxiv - Cell Biology 2021Quote: Lentivirus were generated by transfecting HEK293T cells with standard packaging vectors using TransIT-LT1 Transfection Reagent (Mirus Bio, Madison, WI) or Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells were grown in 10-cm dishes and allowed to reach ~70% confluency before transient transfection using TransIT-2020 (Mirus), according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... the above-described PiggyBac-derived plasmid was transfected into KO Fhl1 HEK 293T cell line using TransIT-X2 reagent (Mirus). Next day ...
-
bioRxiv - Biophysics 2020Quote: Lentivirus was generated by transfecting HEK39T cells with standard 4th generation packaging vectors using TransIT-LT1 Transfection Reagent (Mirus Bio). Media was changed 10 hours post-transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bait and prey plasmids containing fused fragments were then individually transfected together with VSVG and gag/pol packaging vectors in a ratio of 3:1:1 into HEK293T cells using Trans-IT Transfection reagent (Mirus) to produce retroviruses ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RSV-REV in the ratio of (3:1:1:1) into HEK293T cells using Trans-IT transfection reagent (Mirus). Virus-rich supernatant was collected at 72 hr post-transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lentiviral particles were produced by co-transfection of shRNA plasmids with psPAX and pMDG.2 in 293T cells using the Trans-IT LT-1 transfection reagent (Mirus). DM cells were infected by shRNA lentivirus twice via spinoculation in the presence of 5 μg/mL polybrene (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... 1 x 106 Jurkat cells expressing Strep-tagged ADAP1 or GFP were resuspended in 0.1 mL Mirusbio ingenio (Mirus, MIR50115) solution containing 2 μg of TF-responsive reporters driving Firefly luciferase (pGL3-3xAP1-luciferase (Addgene ...
-
bioRxiv - Immunology 2022Quote: ... Cells were transiently transfected with 500 ng of total DNA and 1.5 µl of Transit X2 (Mirus Bio, Madison, WI) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins were expressed in RPE1 or HeLa cells for 24–48 h using TransIT®-LT1 Transfection Reagent (Mirus Bio) or Neon Electroporation (ThermoFisher ...
-
bioRxiv - Microbiology 2022Quote: ... Interactions with codon-optimized MECR- and cMECR-mCh fusions were tested by transfecting 293T cells with mammalian expression constructs using TransIT-X2 (Mirus) for 48 h ...
-
bioRxiv - Molecular Biology 2020Quote: FLAG*-tagged 3A plasmid DNA were directly transfected in HeLa cells for performing immunofluorescent imaging and co-immunoaffinity purification assays using TransIT transfection reagent (Mirus) by following the manufacturer’s recommended protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... 10cm-plate cultures of indicated cell lines were transfected/infected with indicated constructs using TransIT-Insect transfection reagent (Mirus, #MIR6100) for S2 cells ...
-
bioRxiv - Microbiology 2019Quote: ... 100ng of RIG-I agonist derived from the 3’-UTR of hepatitis C virus (19) was transfected per 1e6 cells using TransIT-mRNA transfection kit (Mirus). For stimulation of MDA5 signaling ...
-
bioRxiv - Genetics 2020Quote: WT or mutant mini-genes were transfected in triplicates into COS-7 and ARPE-19 cells using TransIT-LT1 Transfection Reagent (Mirus). Cells were harvested 36h after transfection and total RNA was extracted using Quick-RNA MiniPrep Plus kit (ZYMO Research) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pMD2.G (VSVG envelope vector) vectors were transfected into HEK293T cells in 94 mm2 dish using TransIT-LT1 Transfection Reagent (Mirus). The supernatants containing virus particles was collected at 72 hours after transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... Retrovirus was produced by transfection of Lenti-X 293T cells with packaging constructs and viral expression vector using TransIT-293 (Mirus). Viral supernatant was harvested 48hr later transfection and filtered through a 0.45 μM filter ...
-
bioRxiv - Cancer Biology 2021Quote: ... with ATRX gRNA or vector control were transfected into newly derived primary soft tissue sarcoma cell lines (KP) using the TransIT-LT1 transfection reagent (MIR2304, Mirus). Forty-eight hours after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and the corresponding cargo plasmid were transfected into 293T cells with the TransIT-LT1 transfection reagent (Mirus, Cat No. MIR230). 48 hours following transfection ...
-
bioRxiv - Immunology 2021Quote: ... purified using a Nucleospin kit (Machery-Nagel) and transfected into 2 mL of 293F cells (0.5 mL/mL) using TransIT-Lenti (Mirus bio). The virus was amplified ...