Labshake search
Citations for Mirus Bio :
201 - 242 of 242 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and 5 μg of pSBbi or pSBtet containing gene of interest using TransIT-LT1 transfection reagent (Mirus Bio), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 250 μl of OptiMEM media and supplemented with 2 μl TransIT-2020 Transfection Reagent (Mirus, MIR5400). The transfection mix was incubated 20 min at room temperature and then added to the cell culture for 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 cells were transfected with lentiviral DNA following the Mirus-LT1 (Mirus MIR 2300) transfection protocol ...
-
bioRxiv - Microbiology 2021Quote: ... cells were transiently transfected with 19 μg pNL4-3 or the respective proviral DNA using TransIT®-LT1 transfection reagent (Mirus Bio LLC) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: 3×105 cells were seeded in 6-well plates and transfected with 3CLpro plasmids via TransIT-PRO (Mirus Bio LLC, Madison, WI, USA) and incubated overnight ...
-
bioRxiv - Microbiology 2019Quote: ... and varying input (50 ng for 5-site screen and 15 ng for 4-site screen) of MxA plasmids were co-transfected into HEK 293T cells using the reagent TransIT-LT1 (Mirus Bio) in a 96-well plate format ...
-
bioRxiv - Cell Biology 2020Quote: ... together with the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at a 10:7.5:5 ratio using TransIT-293 reagent (Mirus). The supernatant containing the viral particles was collected 48 hrs after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Cell Biology 2024Quote: ... the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at 10:7.5:5 ratio using TransIT-293 Transfection Reagent (MIR2704, Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Szczesny) and 0.8 μg EGFP-CHIP plasmid using Mirus reagents: 2 ul TransIT-293 (MIR 2700, Mirus) for transfection of HEK293 Flp-In T-REx cells and 2 ul Trans-IT-HeLa and 1.3 ul Monster (MIR 2900 ...
-
bioRxiv - Immunology 2022Quote: H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transfected with 10 ug of the TRE library ± 5 ug of pcDNA3.1 containing a GPCR expression cassette using TransIT-2020 (Mirus Bio) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... transfected at confluence (Day -2) using Mirus TransIT-X2 transfection reagent (3ul per well; Mirus Bio LLC, US) and 250 ng plasmid DNA (either empty vector or FABP4 sgRNA) ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with 2 μg of DNA 24 - 48 hours before measurement using TransIT transfection reagents (Mirus). DRG neurons from adult (postnatal weeks 8–12 ...
-
Prom1 and Notch regulate ciliary length and dynamics in multiciliated cells of the airway epitheliumbioRxiv - Cell Biology 2022Quote: ... The VSV-G pseudotyped lentivirus was packaged by 5 plasmid co-transfection of HEK293T cells using TansIT Transfection Reagent (Mirus Bio) in 15 cm culture dishes (The protocol describing production of lentiviral particles can be found at http://www.www.bu.edu/dbin/stemcells/protocols) ...
-
bioRxiv - Microbiology 2020Quote: ... were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The final CPER product was transfected into Vero E6-TMPRSS2 cells seeded into 6-well plates (~ 5 × 105 cells per well) by using the TransIT-X2 Dynamic Delivery System (Mirus Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... for transfection of HEK293 Flp-In T-REx cells and 2 ul Trans-IT-HeLa and 1.3 ul Monster (MIR 2900, Mirus) for HeLa Flp-In T-REx cells ...
-
bioRxiv - Microbiology 2020Quote: BHK-21 cells were seeded in 48-well plates at 5×104/well in DMEM-10% one day prior to transfection with 500ng of different species ACE2-expression constructs or empty vector (pDISPLAY) (Sup.Table.2) in OptiMEM and TransIT-X2 (Mirus) transfection reagent according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... cells were transfected with a plasmid encoding for SARS-CoV-2 S-glycoprotein (YP_009724390.1) harboring a C-terminal 19 aa truncation using TransIT-Lenti (Mirus Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caco-2 cells were plated (10·106 cells) in 500μl of the Ingenio electroporation solution (Mirus Vio, Wisconsin, USA). The transfected cells were selected using the antibiotic geneticin/G418 (Gibco-Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were transfected with 25 nM scramble or PLIN 5 siRNA (Dharmacon, Lafayette, CO, USA) using TransIT-TKO (Mirus Bio LLC) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: TDP-43 inducible knockdown SH-SY5Y cells were electroporated with 2 μg of DNA with the Ingenio electroporation kit (Mirus) using the A-023 setting on an Amaxa II nucleofector (Lonza) ...
-
bioRxiv - Immunology 2020Quote: HEK293T cells were transiently transfected with mRNA encoding SARS-CoV-2 WT S or S-2P protein using a TranIT mRNA transfection kit (Mirus). After 24 hr ...
-
bioRxiv - Immunology 2019Quote: ... and pZIP-mCMV-ZsGreen-shRNA NT Control or mTOR plasmids (2 µg; Transomic) using the TransIT-LT1 transfection reagent (Mirus) as per manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... purified using a Nucleospin kit (Machery-Nagel) and transfected into 2 mL of 293F cells (0.5 mL/mL) using TransIT-Lenti (Mirus bio). The virus was amplified ...
-
bioRxiv - Genomics 2023Quote: ... 4ug of packing plasmids psPAX.2 and 2ug of the envelope vector pMD2.G diluted in OptiMEM medium and Trans-Ltl transfection reagent (Mirus). For the generation of gRNA lentivirus ...
-
bioRxiv - Cell Biology 2020Quote: ... SK-MEL-2 cells were seeded on 18 mm coverslips at a density of 2 × 105 cells and transfected using TransIT-X2 (Mirus Bio) according to manufactures’ instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Iso-2 and Cdk1 and its mutant plasmids were transfected into the cells using TransIT-X2 transfection reagent (Mirus, cat# MIR6000). siRNA oligonucleotides specific for Rad 51 were purchased from Sigma (ESIRNA HUMAN RAD51 EHU045521) ...
-
bioRxiv - Genomics 2022Quote: ... in HK-2 human proximal tubule cells at approximately 70% confluency in 96-well plates by using TransIT-2020 Reagent (Mirus, #5404), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected with 250 ng of a pCDNA3.1(+) vector encoding for the SARS-CoV-2 spike protein using the TransIT®-LT1 Transfection Reagent (Mirus Bio). Six hours post transfection (p.t.) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 x 105 cells were seeded in 12-well plates and transiently transfected with 2 μg of a plasmid encoding HCoV-OC43 N or eGFP with TransIT-LT1 Transfection Reagent (Mirus Bio). At indicated time post transfection ...
-
bioRxiv - Microbiology 2024Quote: ... 80% confluent monolayers of Vero E6 cells in 12-well plates were transfected with 1.0 μg per well of infectious SARS-CoV-2 BAC DNA or its mutated derivatives using TransIT®-LT1 transfection reagent according to manufacturer’s instructions (Mirus Bio). At 48 h post transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Two samples each were treated with Opti-MEM with 2 µg of transfection DNA (either pJG01, or negative control without DNA) along with TransIT-X2 transfection reagent (Mirus Bio) premixed and allowed to incubate 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... were plated at 2 × 105 cells/mL in 2 mL in 6-well plates one day prior to transfection using TransIT-LT1 reagent (Mirus Bio LLC) with 3 μL of transfection reagent per μg of DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were passaged to 12-well tissue culture plates at a density of 1.5×105 cells/well (3.9×104 cells/cm2) and transfected with 500 ng plasmid DNA using 2 uL of TransIT-X2 transfection reagent (Mirus Bio, #MIR6005) and 100 uL Opti-MEM I reduced serum medium (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: 293T cells were seeded at 2 × 105 cells/well in 6-well plates the day before transfection using TransIT-LT1 reagent (Mirus Bio LLC) at 3 μL transfection reagent/well as previously described 57 ...
-
bioRxiv - Microbiology 2022Quote: HEK293T were seeded at 2 × 105 cells/well in 6-well plates the day before transfection using TransIT-LT1 reagent (Mirus Bio LLC) at 5.8 μL transfection reagent/well ...
-
bioRxiv - Neuroscience 2023Quote: ... H1 plasmid library with the top 5 sgRNA per gene21 were transfected into HEK293s using the TransIT®-Lenti Transfection Reagent (Mirus, Cat. No. MIR 6606) along with third generation lentiviral packaging mix ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were transfected with a SARS-CoV-2 orf-expressing plasmid and the packaging plasmids using TransIT-LT1 transfection reagent (Mirus Bio, Madison, WI) according to the provider’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Transient transfection of FLAG-NMNAT1 and FLAG-NMNAT2 constructs (see Supplemental Table 2) was performed at ∼60% confluence using TransIT®-LT1 transfection reagent (Mirus Bio, Madison, WI) according to manufacturer’s instructions ...