Labshake search
Citations for Mirus Bio :
51 - 100 of 242 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... or Transit LT-1 (Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Transit LT-1 (Mirus).
-
bioRxiv - Microbiology 2022Quote: ... 1 µl of mRNA Boost Reagent and 1 µl of TransIT-mRNA Reagent (Mirus Bio) and incubated for 5 min at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... and psPAX2 at a ratio of 1:1:0.1 using TransIT-LT1 transfection reagent (Mirus). The resulting blend was then filtered through a cellulose acetate membrane (0.45 µm ...
-
bioRxiv - Neuroscience 2023Quote: ... and pHR: mU6-sgRNA-EF1A-puro-P2A-BFP (sgRNA-BFP) (1:1:1) using 24 μL TransIT®-LT1 Transfection Reagent (Mirus Bio, Cat. No. MIR 2300) in a final volume of 1000uL Opti-MEM medium (ThermoFisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were seeded into 14.5 cm dishes and transfected with 40 µg pTK-SM-N100-GFP-V5 expression vector using TransIT-2020 (Mirus Bio; 1 µg DNA: 2 µL reagent), delivered in Opti-MEM ...
-
bioRxiv - Biophysics 2020Quote: ... Transfection of COS-7 cells was performed with TransIT-X2 transfection reagent (Mirus Bio, US) according to manufacturer’s instructions 24 hours after cell seeding and at least 22 hours before fixation ...
-
bioRxiv - Biophysics 2021Quote: ... 7 μg of DNA was mixed with 21 μL of Trans-IT LT1 transfection reagent (Mirus) or LipoD transfection reagent and 1750 μL DMEM and incubated at RT for 20 minutes to allow formation of DNA/transfection reagent complexes before addition to the cells ...
-
bioRxiv - Cell Biology 2023Quote: ... For the complementation assay 100ng of total DNA (1:1 ratio of plasmids) was transfected into 293T cells in 96-well plates using TansIT(R)-LT1 (Mirus) transfection reagent according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection was performed using TransIT-LT-1 (Mirus) transfection reagent and 2500ng plasmid/flask ...
-
bioRxiv - Cell Biology 2023Quote: ... and pMDLg/pRRE) at a 1:1 ratio and transfected into HEK293T cells using TransIT LT1 transfection reagent (Mirus Bio LLC). After 72 h virus-containing supernatants were collected ...
-
bioRxiv - Cell Biology 2023Quote: Differentiated N2a cells were transfected with mRFP or syn-p2a-mRFP (1 μg) and mito GcaMP6f (1 μg) using TransIT-X2® Dynamic Delivery System (Mirus Bio) according to manufacturer’s instructions before reculturing in normal medium for 24 hours ...
-
bioRxiv - Genomics 2020Quote: ... Transit LT-1 reagent (cat. # MIR 2300) from Mirus Bio ...
-
bioRxiv - Microbiology 2022Quote: ... by Trans IT LT-1 (Mirus Bio, Madison, WI). Single cell clones were established by the limit dilution method ...
-
bioRxiv - Genomics 2023Quote: ... Transit LT-1 reagent (cat. # MIR 2300) from Mirus Bio ...
-
bioRxiv - Microbiology 2022Quote: ... indicated plasmids were transfected using LT-1 Reagent (Mirus) and cells were then fixed with 5% methanol-free formaldehyde or treated with IFN or TNF-alpha before fixation ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL TransIT-LT1 transfection reagent (Mirus Bio) was mixed with 15 µL Opti-MEM (Thermo ...
-
bioRxiv - Biophysics 2022Quote: ... and 3 μL of TransIt LT1 (Mirus #MIR2305). Stable clones were selected by growing in DMEM containing 0.5 μg/μL puromycin (Sigma-Aldrich #P8833-25MG ...
-
bioRxiv - Microbiology 2021Quote: A ~7 kb PCR product was fluorescently labeled as described previously11 using the Cy3 LabelIT kit (Mirus Biosciences) as per manufacturer recommendations ...
-
bioRxiv - Molecular Biology 2019Quote: ... RRE and REV using TransIT LT-1 transfection reagent (Mirus). Viral transductions were performed in the presence of 4-8 µg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... pTM-P and 1 pTM-L using TransIT-LT1 (Mirus) and incubated at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... 3 ul of TransIT-LT1 reagent (Mirus Bio LLC) transfection agent was used per ug of DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 µl Mirus TransIT-LT1 transfection reagent (Mirus #MIR2300), and up to 1 µg of plasmid DNA ...
-
bioRxiv - Genetics 2020Quote: WT or mutant mini-genes were transfected in triplicates into COS-7 and ARPE-19 cells using TransIT-LT1 Transfection Reagent (Mirus). Cells were harvested 36h after transfection and total RNA was extracted using Quick-RNA MiniPrep Plus kit (ZYMO Research) ...
-
bioRxiv - Neuroscience 2023Quote: ... COS-7 cells cultured on coverslips were transfected with the indicated expression vectors using TransIT-LT1 Transfection Reagent (Mirus bio) and maintained for 24 h ...
-
bioRxiv - Molecular Biology 2022Quote: Transfections were performed using Trans-IT LT1 (TLT-1) (Mirus Bio) according to the manufacturer’s instruction.
-
bioRxiv - Genetics 2019Quote: ... two master mixes were prepared: a) LT-1 transfection reagent (Mirus) was diluted 1:10 in Opti-MEM and incubated for five minutes ...
-
bioRxiv - Microbiology 2022Quote: ... by using the TransIT LT-1 transfection reagent (Mirus Bio LLC). Two days later ...
-
bioRxiv - Microbiology 2022Quote: ... Sigma-Aldrich) via the LT-1 transfection reagent (Mirus Bio LLC) in A549 or 293T cell propagation medium ...
-
bioRxiv - Cell Biology 2023Quote: ... and pCG-VSV-G using TransIT-LT-1 transfection reagent (Mirus). Subsequently ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μl of TransIT-X2® transfection reagent (Mirus Bio) was then added to the tube ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Microbiology 2022Quote: ... or 2 µg of pPol1II-HA and 2 µg of pPol1II-NA) using TransIT-293 (Mirus). Virus supernatant was harvested 72 hours post-transfection and filtered through 0.22 µm filters ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... DF-1 cells were transfected using TransIT-LT1 transfection reagent (Mirus Bio).
-
bioRxiv - Developmental Biology 2019Quote: ... These plasmids (1 µg each) were transfected by the TransIT system (Mirus) into 2×106 S2 cells that were plated in 6-well plates one day before analysis ...
-
bioRxiv - Microbiology 2022Quote: ... using 6:1 TransIT-LT1 Transfection Reagent (Mirus Bio, Madison, WI, USA). One and six days after transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... and either 3 µl Mirus TransIT-X2 transfection reagent (Mirus #MIR6000) for hTERT-RPE1 cells ...
-
bioRxiv - Cell Biology 2022Quote: siRNA was delivered to differentiated adipocytes (6-7 days post-differentiation) using the TransIT-X2® dynamic delivery system (MIR 6004; Mirus Bio). Opti-MEM I (31985062 ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 μg each of Gβ1 and Gγ2-GFP2 using TransIT-2020 (Mirus) as transfection reagent ...
-
bioRxiv - Cell Biology 2021Quote: or from Sigma for universal negative control #1 (SIC001) and were transfected using TransIT-X2 (Mirus) in Opti-MEM media following manufacturer’s recommendation ...
-
bioRxiv - Biochemistry 2019Quote: ... in a 40:1 ratio for 48 h using TransIT 2020 (Mirus Bio) or Dharmafect Duo (Dharmacon) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL of Boost reagent (Mirus Bio) and 2 µL of TransIT mRNA reagent (Mirus Bio) ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Immunology 2019Quote: ... for HeLa and THP-1 cells or TransIT-293 (Mirus Bio LLC, Madison, WI) for 293T cells ...
-
bioRxiv - Systems Biology 2020Quote: ... Following 1 week of incubation with a selection media containing G418 (Mirus Bio LLC) at 1 mg/mL ...
-
bioRxiv - Biophysics 2020Quote: ... Following 1 week of incubation with a selection media containing G418 (Mirus Bio LLC) at 1mg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... AMO1 shIRE1 cl.1 cells were transfected using TransIT-X2 Dynamic Delivery system (Mirus), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... or non-Targeting shRNA vectors pLKO.1 using Mirus Trans-IT TKO Transfection reagent (Mirus). 621-101 cells were transduced with lentiviruses for 48 hours and then selected against puromycin ...