Labshake search
Citations for Promega :
301 - 350 of 2350 citations for mmu mir 212 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... with Oligo(DT)15 Primer (Promega C1101). Q-RT-PCR reactions used Lightcycler 480 SYBR Green I Master Mix (Roche 04707516001 ...
-
bioRxiv - Microbiology 2022Quote: ... using an oligo(dT)15 primer (Promega). Quantitative PCR (primers Tb927.4.1270-F-01 and Tb927.4.1270-R-04 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Oligo(dt) 15 primers (Promega, C1101) containing RNasin® Plus RNase inhibitor (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random primer (Promega, Madison, WI, USA). After the reverse transcription ...
-
bioRxiv - Physiology 2023Quote: ... in the presence of random primers (Promega) and RNase OUT™ (Invitrogen) ...
-
bioRxiv - Physiology 2023Quote: ... and random primers (Promega, Madison, Wisconsin, USA) according to manufacturers’ instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 ng of random primers (Promega, C118A), 0.5 mM dNTPs (NEB ...
-
bioRxiv - Immunology 2023Quote: ... and an Oligo(dT)15 primer (Promega). qPCR was performed with the Fast EvaGreen qPCR Master Mix (Biotium ...
-
bioRxiv - Cell Biology 2024Quote: ... reverse transcription primers and dNTPs (both Promega). Single cell sequencing was performed according to the Sort-seq method13.
-
bioRxiv - Microbiology 2020Quote: ... The presence of the Janus in the nanB gene in P2406 was confirmed by PCR (GO-Taq polymerase, Promega M7123, and primers 83F and 88R). A second PCR amplicon was generated by amplifying and joining the upstream and downstream regions around nanB from Spn P2406 (using primers 1F and 2R and primers 3F and 4R) ...
-
bioRxiv - Molecular Biology 2020Quote: ... EVEN or LacZ probe sets were solubilized in Trypsin Buffer (Promega) for digestion into small peptides ...
-
bioRxiv - Microbiology 2024Quote: Amplification was set up with the qPCR kit (Promega, Madison, WI) and carried out on an ABI7500 with an initial melting temperature of 95°C for 2 mins and 40 cycles of 95°C for 15 sec and 60°C for 1 min ...
-
bioRxiv - Molecular Biology 2019Quote: Validation of hsa-miR-548ba and hsa-miR-7973 direct binding to target gene 3’UTR was performed by using Dual-Glo Luciferase assay system (Promega) according to the user manual ...
-
bioRxiv - Cell Biology 2020Quote: The sequence containing three consecutive perfect matches for hsa-miR-145-5p was excised from pSG5-Luc-3xmiR-145 (11) and sub-cloned in pMirGlo (Promega) to generate pMiRGlo 3xmiR-145.
-
bioRxiv - Synthetic Biology 2024Quote: ... Cells were transfected the following day with 1,000 ng of either the control plasmid or the BFP-miR-L plasmid using Fugene HD (Promega #E2311) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Luciferase assays were performed by co-transfecting HEK-293T cells with 100 ng pCMV6-empty or pCMV6-miR-497/195 with 10 ng of psiCHECK2 reporter plasmids using FuGENE6 (E2691; Promega) and performing the Dual-Luciferase Reporter Assay System (E1910 ...
-
bioRxiv - Immunology 2021Quote: ... and pre-amplified with external Iγ3 Fw primer and Cµ Rv primer using GoTaq Green Master Mix (M712B; Promega). Pre-application products were purified with QIAquick PCR Purification Kit (28104 ...
-
bioRxiv - Microbiology 2023Quote: ... AePer50 reverse transcription (RT) and qPCR reactions were performed using GoTaq® 1-Step RT-qPCR System (Promega), with 10 µl of 2X qPCR Master Mix ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse transcribed with AMV RT (Promega) primed with random 9-mers ...
-
bioRxiv - Microbiology 2020Quote: ... GoTaq 1-Step RT-qPCR kit (Promega) was used at a final volume of 20 μl with ...
-
bioRxiv - Plant Biology 2021Quote: ... A One-step RT-qPCR kit (Promega) was used for converting the RNA into cDNA before amplifying target transcripts on a CFX Connect Real-Time PCR Detection System (Biorad) ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcribed by M-MLV RT (Promega) using sRNA0030R1 primer (Table S3) ...
-
bioRxiv - Pathology 2020Quote: ... using GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Molecular Biology 2023Quote: ... and reverse-transcribed using AMV RT (Promega). cDNA was quantified by qPCR using iTaq Universal SYBR green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... and reverse transcribed with AMV RT (Promega) primed with random 9-mers ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse transcribed with MMLV-RT (Promega). The RT reactions were amplified with primers for target RNA and ACTIN (Supplemental Table S2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and reverse transcribed with MMLV-RT (Promega) using oligo-dT primers ...
-
bioRxiv - Microbiology 2023Quote: ... and 1µl of AMV RT enzyme (Promega) for a 50µl reaction volume ...
-
bioRxiv - Cell Biology 2024Quote: ... and reverse-transcribed with AMV-RT (Promega) and random 9-mer primers ...
-
bioRxiv - Microbiology 2023Quote: ... and reverse transcribed using AMV RT (Promega) and random 9-mers in the presence of RNasin (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... with upstream primer UG5953 and downstream primers YA9566 (100 bp) or YA9567 (200 bp) and ligated into pGEM-Teasy (Promega) to create pCB4633 and pCB4634 ...
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Genomics 2022Quote: ... The pRF+423Dux 4 vector was sequenced using primers that anneal to the pGL3 vector (Promega, see primers Table S2). The Dux4 IRES site was deleted from pRF+423Dux4 using PCR primers that flank the IRES region (PRF423DUX4-ATW F and R ...
-
bioRxiv - Genomics 2019Quote: ... 2 μl US bait primer and 2 μl Illumina universal primer 10 μM (0,4 μM final concentration each primer) and 1 μl GoTaq (Promega, M5005) with the following program ...
-
bioRxiv - Molecular Biology 2021Quote: ... PAT-PCR was performed using a 3’ UTR-specific forward primer and a y300 PAT universal C10 primer with GoTaq Green Master Mix (Promega). The primer sequences are provided in Table S1 ...
-
bioRxiv - Physiology 2022Quote: ... gDNA was purified using Purelink spin columns and PCR amplified with specific primers (see Supplementary Table S2 for primer sequences and annealing temperatures) using GoTaq Hot Start Polymerase (Promega). PCR conditions were 95°C for 3 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... PAT-PCR was performed using a 3′ UTR-specific forward primer and a PAT universal primer with GoTaq Green Master Mix (Promega). The PCR products were separated by 6% PAGE in 0.5× TBE ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from lymphoma derived cell lines as described above and PCR amplified using sgRNA specific primers (Supplementary Table 3, p53 primers as previously described (13) and GoTaq Green Master Mix (Promega). PCR products were amplified a second time using indexing primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT) and sequentially digested with Lys-C (Wako) (protein:enzyme ratio 1:50, o/n at RT) and trypsin (Promega) (protein:enzyme ratio 1:100 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 20 minutes in the dark, RT) and sequentially digested with Lys-C (Wako) (protein:enzyme ratio 1:50, overnight at RT) and trypsin (Promega) (protein:enzyme ratio 1:100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... RT) and sequentially digested with Lys-C (Wako) (protein:enzyme ratio 1:100, o/n at RT) and trypsin (Promega) (protein:enzyme ratio 1:100 ...
-
bioRxiv - Microbiology 2023Quote: ... RT), alkylated (55 mM IAM, 45 min, RT, in the dark) and digested with 0.5 μg of trypsin (Promega). Tryptic peptides were desalted using a POROSTM R2 resin (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... random primers (10 ng/μl, Promega, Wisconsin, USA) and dNTPs (0,5 mM ...
-
bioRxiv - Neuroscience 2020Quote: ... with Random Primers (Promega, Madison, Wisconsin, USA, C1181).
-
Interdependent Iron and Phosphorus Availability Controls Photosynthesis Through Retrograde SignalingbioRxiv - Plant Biology 2021Quote: ... to synthesize cDNA using oligo(dT) primer (Promega). Real-time quantitative reverse-transcription PCR (qRT-PCR ...
-
bioRxiv - Genetics 2022Quote: ... RNAs were annealed with Random Primers (Promega, C118A) and RT was performed with the RevertAid H Minus Reverse Transcriptase (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Oligo(dT)15 primers (Promega, United States) according to the manufacturer’s protocols ...
-
bioRxiv - Immunology 2019Quote: ... with 2 µM Oligo(dT)15 primers (Promega) and 10 U RNase OUT in a 20 µl reaction at 37ºC for 90 min ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA synthesis was performed using random primers (Promega) and M-MLV reverse transcriptase (Promega) ...
-
bioRxiv - Developmental Biology 2021Quote: ... plus 2 uL of random primers (Promega, C1181). This was then incubated at 70 °C for 10 mins ...