Labshake search
Citations for Promega :
651 - 700 of 2350 citations for mmu mir 212 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were cleaned with the Wizard SV Gel and PCR Clean Up Kit (Promega) and cut with XhoI and BamHI or HindIII und BamHI (Thermo Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were purified by the Wizard SV Gel and PCR Clean-Up System (Promega) and quantified using the Qubit dsDNA HS assay (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified with Wizard® SV Gel and PCR Clean-Up System (Promega) and ligated to the pGEM-T easy® vector (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega) and forward and reverse sequences were obtained using an Abi 3130XL Genetic Analyzer (Applied Biosystem ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were purified using the Wizard SV Gel and PCR Clean-up System (Promega). The concentrations of amplified PCR products were measured using the Quant-iT PicoGreen dsDNA Assay Kit (Molecular Probes ...
-
bioRxiv - Bioengineering 2021Quote: ... Input linear DNA was produced by PCR and cleaned with PCR cleanup kit (Promega, A6754), quantified and diluted to desired concentrations using ultra-pure water ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR products were purified with Wizard SV Gel and PCR Clean-Up System (Promega). A volume of 0.75 µl of the DNA templates was mixed in 2.5 µl cell-free protein expression reactions (PUREFrex 2.0 ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR cleanup was conducted using the Wizard SV Gel and PCR Clean-Up System (Promega) with elution in 30 μl of double distilled water ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega) in line with the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: The PCR products representing genomic and cDNA sequences were purified using PCR purification kit (Promega) and subsequently sequenced using Sanger sequencing at Micromon Genomics ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each quantitative RT-qPCR reaction was performed using the GoTaq qPCR Master Mix kit (Promega). For a 10 μl reaction ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and gene expression levels measured using a 1-step RT-qPCR master mix (Promega, UK) and a 7500 Fast qPCR instrument (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2019Quote: ... which were performed with the use of GoScript RT kit following the manufacturer’s instructions (Promega).
-
bioRxiv - Immunology 2021Quote: Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Microbiology 2021Quote: Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Microbiology 2020Quote: ... and cDNA was produced with Moloney murine leukemia virus reverse transcriptase (M-MLV RT) (Promega) and random hexamers ...
-
bioRxiv - Molecular Biology 2022Quote: cDNA was synthesized from nuclear and cytoplasmic RNA using Improm II RT (Promega, Cat. #A3800), and cDNA levels were measured by qPCR using the Brilliant III Ultra-Fast qPCR Kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2019Quote: Extracted vRNA from faecal and tissue samples were reverse transcribed using M-MLV RT (Promega) and random hexamer primers (Roche) ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by reverse transcription (RT) using M-MLV reverse transcription kit (Promega, Madison, WI, USA). Blank qPCR Master Mix kit (EURx ...
-
bioRxiv - Microbiology 2023Quote: Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Neuroscience 2024Quote: ... using BRYT Green Dye contained in the GoTaq 1-Step RT-qPCR kit (Promega: A6020) in the CFX96 Touch Real-Time PCR Detection system (Bio-Rad) ...
-
bioRxiv - Biochemistry 2024Quote: ... plates were placed for 15 min at RT to equilibrate before NanoBRET NanoGlo Substrate (Promega) was added ...
-
bioRxiv - Cell Biology 2021Quote: Realtime-Glo MT Cell Viability assay: The assay was set up as a continuous read format according to the manufacturer’s instructions (Promega, Madison, Wl) in a 96 well format using 5,000 cells/well in a 100ul volume ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized from 1 μg of each RNA sample using Oligo(dT)15 Primer (Promega) and M-MLV Reverse Transcriptase (RNase H Minus ...
-
bioRxiv - Genetics 2021Quote: ... RNA was reverse transcribed to cDNA using random primers and GoScript™ Reverse Transcriptase kit (Promega). RT-qPCR was performed using Firepol qPCR Master Mix (Solis BioDyne ...
-
bioRxiv - Molecular Biology 2020Quote: ... The first strand cDNA was synthesized from 1µg RNA using random primers (Promega, Madison, WI, USA) and purified using the QIAquick PCR purification kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then it was amplified with BSP primers and cloned into pGEMT Easy vector (Promega, Wisconsin, USA). The samples are then sequenced and the data is analyzed by BIQ analyzer.
-
bioRxiv - Genomics 2020Quote: ... and amplified with one of the nine pairs of barcoded FAS_e5_BR_F and FAS_e5_BR_R primers (Baeza-Centurion et al., 2019) and GoTaq flexi DNA polymerase (M7806, Promega). Each pair of primers had a distinct 8-mer barcode sequence to distinguish the nine experimental replicates ...
-
bioRxiv - Microbiology 2021Quote: ... ORF73 and GAPDH genes were detected by PCR utilizing primers 73_IG_US and 73_IG_DS for ORF73 and GAPDHF and GAPDHR for GAPDH in GoTaq polymerase (Promega) as described (33).
-
bioRxiv - Cancer Biology 2021Quote: ... and 100-200 ng of cDNA was synthesized with random primers and reverse transcriptase (Promega, GoScript). Quantitative PCR was performed using 2.5 ng of cDNA in duplicates ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reverse transcription was conducted using GoScriptTM Reverse Transcription Mix and Random Primers (A2800, Promega, WI, USA) according to the manual ...
-
bioRxiv - Microbiology 2022Quote: ... A 666 bp fragment of MycFOLD-17 cDNA was amplified using the gene-specific primers MF17_ISH_F (ATGAGAATATTTTCGGCTCAA) and MF17_ISH_R (TCAGTCAGTTATCCAAGCAGC) and ligated into the pGEM-T Easy vector (Promega) and used as a template for in vitro transcription using the Digoxygenin (DIG ...
-
bioRxiv - Immunology 2022Quote: ... 0.5 μl 10 μM Reverse primer and 0.125 U/μl GoTaq DNA Polymerase (Promega, Madison, WI) were mixed to make a 25 μl PCR reaction mix (key resource table) ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was produced using random hexamers as primers and the GoScriptTM Reverse Transcription kit from Promega. Amplification of 16S rRNA and fcrX cDNA was made using SsoFast EvaGreen Supermix 2X kit (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... primers designed for the gene of interest (Table 1) and GoTaq(R) qPCR Master Mix (Promega). Samples were run on an AB 7300 Real Time PCR System (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Purification was performed to remove adaptors and primer dimers using the Wizard Genomic DNA Kit (Promega) and quality was verified by measuring the quantity and length of the fragments ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was reverse transcribed using oligo(dT) primers and MMLV reverse transcriptase (Promega, PR-M1705) to generate cDNA ...
-
bioRxiv - Physiology 2024Quote: ... Reverse transcription was performed using oligo(dT) primers and M-MLV Reverse Transcriptase (Promega, Madison, WI) at 42°C for 1 hour according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The two PCR-amplicons were fused by overlap extension PCR and cloned into pGEM-T (Promega) by TA cloning ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were concentrated and gel purified using Wizard SV Gel and PCR cleanup protocol (Promega). Binding reactions consisted of the manufacturer’s binding buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR products were purified with the Wizard SV Gel and PCR Clean-Up System (Promega) and cloned into the pGEM-T Easy Vector (Promega ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The PCR products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified using a Wizard® SV Gel and PCR Clean-up System (Promega). Samples were barcoded using Oxford Nanopore PCR barcodes (EXP-PBC001 ...
-
bioRxiv - Immunology 2022Quote: ... The PCR product was then purified using the Wizard SV 96 PCR Clean-Up System (Promega) and barcoded in a second PCR using two-sided six-nucleotide barcoded primers to discriminate between TCRs of different T cell populations ...
-
bioRxiv - Zoology 2020Quote: ... PCR products were purified with the Wizard SV Gel and PCR Clean–Up System (Promega, USA) and sent for sequencing to Macrogen Inc ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products were purified (Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI)) and sequenced at the UC Davis DNA Sequencing Facility http://dnaseq.ucdavis.edu/.The DNA sequences were compared against the National Center for Biotechnology Information (NCBI ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR products were purified using the Wizard SV Gel and PCR Clean-up System (Promega). Purified genomic DNA and RT PCR products (100 ng ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR reaction mixture was formulated using 5 μl GoTaq G2 green PCR master-mix (Promega, USA), 1 μl primer (forward and revers ...