Labshake search
Citations for Promega :
701 - 750 of 2350 citations for mmu mir 212 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: PCR products containing the trigger T7 transcriptional unit were cleaned by PCR cleanup kit (Promega, A6754) and 250 ng were processed by in vitro transcription using the HiScribe T7 kit (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR fragment was gel-purified using Wizard SV gel and PCR Clean-up System (Promega), ligated into pGEM-T (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification of exon 2 of the NR2F2 gene was performed using PCR Master Mix (Promega; primer pair is listed in Appendix Table S1) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the Wizard SV Gel and PCR Clean-Up System kit (Promega) and ligated into pET17b vector using the Gibson Assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the Wizard® SV Gel and PCR Clean-Up system (Promega) and then sequenced by Sanger sequencing at GENEWIZ (South Plainfield ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR master mix (Promega, USA) was used as per the manufacturer instructions to amplify the 16s rRNA marker gene ...
-
bioRxiv - Microbiology 2022Quote: ... PCR product was column purified (Promega) for subsequent in vitro transcription of nsp4 RNA using mMESSAGE mMACHINE T7 Transcription Kit (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Standard PCR conditions for GoTaq (Promega) were used as follows ...
-
bioRxiv - Plant Biology 2019Quote: ... GoTaq PCR Mastermix (Promega, Mannheim, Germany) was used to monitor cDNA amplification ...
-
bioRxiv - Developmental Biology 2020Quote: ... 64 µM PCR Nucleotide Mix (Promega), 1.5 mM MgCl2 and 0.2 µM of upstream and downstream primer each ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was column purified (Promega) for subsequent in vitro transcription of N RNA using mMESSAGE mMACHINE T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... PCRs were performed using GoTaq (Promega) on a Veriti thermal cycler (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed with GoTaq (Promega) and with primers listed in Table S9.
-
bioRxiv - Evolutionary Biology 2022Quote: ... or Wizard PCR purification kit (Promega), and then directly sequenced using the same and internal primers on an ABI 3130xl sequencer.
-
bioRxiv - Microbiology 2023Quote: ... [26]) and PCR chemicals by PROMEGA© with the following PCR conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR nucleotide mix (Promega, U144B). Quantitative PCRs were performed in triplicate using primers against BNIP3 (Pair 1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... TaqMan universal PCR master mix (Promega) and the CFX96 Touch Real-Time PCR Detection System (BioRad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR nucleotide mix (Promega, #U144B) were used to synthesise cDNA from 1 mg of RNA ...
-
bioRxiv - Microbiology 2023Quote: ... 0.2 mM PCR Nucleotide Mix (Promega) 10 μM of each primer ...
-
bioRxiv - Cell Biology 2020Quote: ... A total of 250 µL of BMB was added to each well and the optical density of the samples was read using a Glomax plate reader set at 525 nm (Promega, Madison, USA). The amount of GAG in each sample is expressed as a percentage of the dry weight of the digested ECM.
-
bioRxiv - Developmental Biology 2019Quote: ... RT-qPCR was performed with GoTaq® qPCR Master Mix for Dye-Based Detection (Promega, A6001) using a CFX Connect Bio-Rad qPCR System ...
-
bioRxiv - Immunology 2020Quote: ... 500-1500ng of extracted RNA were used for each RT reaction using either M-MLV (Promega) or RevertAid (ThermoFisher ...
-
bioRxiv - Immunology 2019Quote: ... Reverse transcription (RT) was carried out using 2.5 U avian myeloblastosis virus (AMV) reverse transcriptase (Promega) and a 32P-labelled primer in the presence of 4 mM MgCl2 and 0.5 mM dNTPs ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR reactions were performed using the GoTaq 1-Step RT-qPCR System (Promega GmbH, Walldorf, Germany). 100 ng of isolated mRNA were used per reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... The plate was incubated for 40 min at RT before reading luminescence using GloMax Explorer (Promega) plate reader ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized with 1 μg/μL of RNA concentration using MMLV-RT enzyme (Promega, USA). HvHsfA6a gene specific and Actin primers designed by using Primer express 3.0 software (Thermoscientific USA ...
-
bioRxiv - Biochemistry 2024Quote: ... plates were equilibrated to RT for 15 min and CellTiter Glo reagent (Promega, Madison, WI, USA) was added followed by orbital shaking for 2 min ...
-
bioRxiv - Immunology 2021Quote: ... Reverse transcription of the extracted RNA was performed using 1μl of 0.5μg/μl OLIGO dT primers (Promega) and 1μl of RNase free-water and incubating samples at 70°C for 10 minutes and cooling for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... ribosome positioning was determined by primer extension/reverse transcription using AMV reverse transcriptase (1 U/μl) (Promega) in the presence of 125 μM of each of dTTP ...
-
bioRxiv - Microbiology 2019Quote: ... The reaction mixture (25 μL) used for cDNA synthesis contained 1⋅25 μM random hexamer primers (Promega), 250 μM of each deoxynucleoside triphosphate (dNTP) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription was performed with random hexamer primers (R6) and M-MLV reverse transcriptase (Promega, Madison, WI) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... using both reverse transcriptase and oligo(dT) primers provided with the cDNA Synthesis kit (Promega, United States). RT-qPCR was performed according to the Power SYBR Green Master Mix protocol (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... the RNA was eluted in Milli-Q water and using 0.5 μg of random hexamer primers (Promega) and the M-MLV reverse transcriptase system (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized from 2µg of DNA free RNA using MMLV reverse transcriptase and random primers (Promega). Quantification of the cDNA was carried out in the Rotor gene 3000A machine (Corbett ...
-
bioRxiv - Cell Biology 2022Quote: ... gDNA was amplified using primers 5’-AGTCCCTTCCTTGTCACTTAGT-3’ and 5’-ATCTCACAAGAAAGCGAAATCC-3’ and GoTaq DNA Polymerase (Promega), then digested using EcoRV (New England Biosciences) ...
-
bioRxiv - Microbiology 2022Quote: ... Amplification was carried out with primers 27F and 1391R (Lane, 1991) using GoTaq® DNA polymerase (Promega) according to the manufacturer’s instructions ...
-
Dynamic Effects of Ventral Hippocampal NRG3/ERBB4 Signaling on Nicotine Withdrawal-Induced ResponsesbioRxiv - Neuroscience 2023Quote: ... and 500 ng of RNA was reverse transcribed into cDNA using Oligo dT primer (Promega, Madison, WI) and Superscript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA was retrotranscribed into cDNA using M-MLV reverse transcriptase with Oligo(dT)15 primers (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The primer pair (5′- accagacggagtttgagcgcgtcttcTGAGGAGGATCCGGTGGAGCTAGCGGAAGA-3′ and 5′-ctccaccgagtcgtactgcttcgccatACCAGAATTCCCACCGCTCGAGCCA-3′) and pBit3.1-N (Cat. No. N2361, Promega) were used to clone the vector-containing fragment ...
-
bioRxiv - Physiology 2023Quote: ... primers at a final concentration of 300nM and 6µL of GoTaq® qPCR Mix (Promega, Madison, USA). qPCR conditions were the following ...
-
bioRxiv - Genomics 2023Quote: ... Primer efficiency was calculated using a 10-fold serial dilution of Human Mixed Genomic DNA (Promega G3041). For primer sequences and calculated efficiencies ...
-
bioRxiv - Genetics 2023Quote: ... which were introduced by amplification of the plasmid with the indicated mutation primers followed by DpnI (Promega) digestion ...
-
bioRxiv - Bioengineering 2020Quote: ... Homozygous lpat2-3 T-DNA insertional mutants were identified by PCR using Promega PCR Master Mix (Promega) and combinations of the gene specific and T-DNA left border primers pairs ...
-
bioRxiv - Microbiology 2020Quote: ... The dcas9 PCR amplicon was purified using a Wizard SV Gel and PCR Clean-up kit (Promega) and digested with AscI and HindIII ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was then purified using the Wizard® SV Gel and PCR Clean-up System (Promega) and quantified using NanoDrop™ technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing Proteinase K and target regions were amplified by PCR using the GoTaq G2 PCR mastermix (Promega). Correct and unique amplification of the target regions was verified by agarose gel electrophoresis before purifying PCR products using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were purified using the Wizard SV Gel and PCR Clean-up System (A9281, Promega) and the purified templates were used to produce single stranded digoxigenin (DIG)-labelled RNA probes with the T7 (P2075 ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 725bp segment of the Svep1 transcript (NM_153366.4; 746-11179) was PCR amplified (PCR Master Mix, Promega) with one pair of exon-exon boundary overlapping primers (5’ TGTGGTCCTCCAAGTCACGTA 3’ ...
-
bioRxiv - Immunology 2020Quote: ... The PCR fragment was cleaned up using the Wizard SV Gel and PCR Clean-up System (Promega). The fragment was digested with EcoRI-HF and HindIII-HF (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was run on the agarose gel and purified using PCR purification kit (A1222, Promega). The Alu PCR product was cloned into using pGEM-T Easy Vector (A1380 ...