Labshake search
Citations for Promega :
651 - 700 of 935 citations for Mouse Anti Human IgG Fc Alexa Fluor 405 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Insulin and NEFA levels were using a mouse insulin ELISA kit (Promega) and WAKO NEFA-C kit (WAKO ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were cultured in 96 well plates and metabolic activity was measured using Cell-Titer-Glo assay or CellTiter-Fluor™ Cell Viability Assay (Promega, USA), as per manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: HeLa cells expressing each Halo-tagged chromatin remodeler were labeled with 5 nM Janelia Fluor® 549 (JF549) Halo-tag® ligand (GA1110, Promega) for 15 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... mEPCs were incubated with 100 nM SiR-tubulin (Spirochrome, SC002) for 30 min or 200 nM Janelia Fluor® 549 HaloTag ligand (Promega, GA1110) for 20 min ...
-
bioRxiv - Biochemistry 2020Quote: The two Munc13-Halo proteins were labeled by incubating the protein with Alexa 488 conjugated with HaloTag® from Promega, as described before (2) ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 3.6 kbp human CDC37 promoter region was PCR amplified and subcloned into a pGL3-luciferase vector (Promega, Madison, WI) using KpnI and BamHI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were co-transfected with pcDNA5/FRT construct encoding haemagglutinin (HA)-tagged human CB1 receptor cDNA and pOG44 (Flp recombinase plasmid) using transfection reagent Fugene HD (Promega) as previously described for AtT-20 pituitary tumour cells [26] ...
-
bioRxiv - Genomics 2019Quote: To generate recombinant p53 we in vitro transcribed/translated human p53 with a c-terminal HA tag using a rabbit reticulocyte system (Promega). To generate fragmented genomic DNA we tagmented 50ng of human genomic DNA from MCF7 cells using the MuSeq kit (Thermo ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Physiology 2021Quote: ... Plasmid DNAs coding for hSlo1 (AAB65837 in pCI-neo) and human β1 (AAH25707) or β4 (KJ893642) were transfected into the cells with either FuGene6 (Promega) or GenJet v ...
-
bioRxiv - Biochemistry 2021Quote: ... yeast (Saccharomyces cerevisiae) cell protein extract (Cat# V7341, V7461), and human K562 cell protein extract (Cat# V6951, V6941) were purchased from Promega Inc (WI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: A putative promoter region of 600bp encompassing the TSS of the human VDACs genes was selected from GenBank and cloned into pGL3 basic vector (Promega) for transcriptional activity study ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Biochemistry 2022Quote: ... GS-mediated GS-cAMP accumulation assays were performed with HEK293T (ATCC CRL-11268) cells transiently expressing human D1R or D5R wild-type and mutant along with the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20 000 cells/35 μL/well ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we amplified FES exons 9 to 11 with intervening sequences and SH3BP2 exons 9 to 11 with intervening sequences from human genomic DNA (Promega), and cloned the products into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends53 in pCI (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: HEK293T cells were transfected with a FLAG-tagged human DHHC20-expressing plasmid and a corresponding HA-tagged substrate-expressing plasmid using FuGENE transfection reagent (Promega) and incubated overnight ...
-
bioRxiv - Molecular Biology 2023Quote: The sequences of wild-type (WT) F8 exons and 100-250 nucleotides flanking each exon were amplified from human genomic DNA (Promega) using WT PCR primers shown in Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1,200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends in pCI mammalian expression vector (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Immunology 2023Quote: Pyroptotic cell death was measured by assessing LDH-release in the cell culture supernatant of human and murine macrophages using a CytoTox 96 Non-radioactive Cytotoxic Assay (Promega) following the manufacturer’s recommended procedures.
-
bioRxiv - Developmental Biology 2024Quote: ... Total peptide concentration was adjusted to 0.15 µg/µL according to the absorbance at 280 nm against a Mass Spec-Compatible Human Protein Extract/Digest calibration curve (Promega), using the Thermo Nanodrop 1000 ND-1000 spectrophotometer (Thermo Fisher).
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2020Quote: ... an immunoblot with anti-halo antibody (Anti-HaloTag® Monoclonal Antibody-Promega) was performed to confirm protein expression and binding efficiency for each TF ...
-
bioRxiv - Microbiology 2019Quote: ... containing 3ng of mouse GAPDH RNA (in-vitro transcribed using T7 RiboMAX (Promega), as per manufacturer’s protocol) ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA encoding the full-length mouse HCN2 was cloned in pCI (Promega) mammalian expression vector ...
-
bioRxiv - Developmental Biology 2020Quote: ... The primary antibodies that were used are mouse β-Gal (1:250; Promega), mouse anti-Cora C615.16 (1:400 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each mouse was injected intraperitoneally with 100mg/kg luciferin potassium salt (Promega, France). After mice were anesthetized ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-rabbit (Promega, W401B) antibodies at a concentration of 1:10 000 and anti-rat IgG1 (Monoclonal Antibody Core Facility ...
-
bioRxiv - Microbiology 2021Quote: ... anti-Halo-tag (Promega), anti-FLAG (M2 ...
-
bioRxiv - Physiology 2022Quote: ... Anti-rabbit (Promega, #W401B), anti-guinea pig (JacksonImmuno ...
-
bioRxiv - Cancer Biology 2019Quote: ... rabbit anti-pJNK (Promega) at 1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-Halo (G9211; Promega), anti-Tubulin (100109-MM05T ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-rabbit (Promega, #W401B) and anti-chicken (Promega ...
-
bioRxiv - Immunology 2021Quote: ... or anti-goat (Promega) secondary antibodies conjugated to horseradish peroxidase ...