Labshake search
Citations for Promega :
4601 - 4650 of 5396 citations for Rat Protein Glutamine Gamma Glutamyltransferase 2 TGM2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Total genomic DNA was isolated from overnight cultures of Ag1 and Ag2 using the Genome Wizard kit (Promega, WI), following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... cells were collected to measure the firefly luciferase and renilla luciferase luminescent activities using the Dual-Luciferase Reporter Assay kit (Catalog:E1910, Promega) with 96-well plates (Nunc MaxiSorp ...
-
bioRxiv - Microbiology 2023Quote: ... The sequence of the plasmid was verified by sequencing using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega). To generate a pDON-5 Neo-vector expressing IFNAR1 with the W70C mutation ...
-
bioRxiv - Cancer Biology 2023Quote: Total cholesterol and triglycerides from cells were determined by using Cholesterol/Cholesterol Ester-GlowTM assay kit (Promega, Madison, WI) and Triglyceride-GlowTM assay kit (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 25 µl of CellTiter-Glo® reagent from CellTiter-Glo® luminescent cell viability assay kit (Promega, Southampton, UK) was added to each well and mixed for 2 minutes on a plate shaker and incubated at room temperature (RT ...
-
bioRxiv - Neuroscience 2023Quote: RNA from lyophilized cerebrum and brainstem samples was extracted using the Maxwell® RSC simplyRNA Tissue Kit/Instrument (Promega) with initial homogenization on a TissueLyser LT (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Caspase CP and CAEC apoptosis was determined after treatment with hemin or vehicle using a Caspase glo kit (Promega) according to manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA (1-2 μg) was reverse transcribed with a GoScriptTM Reverse Transcriptase cDNA reverse transcription kit according to the manufacturer’s instructions (Promega Corporation ...
-
bioRxiv - Genomics 2023Quote: ... DNA of plant selected at this stage was extracted from rosette leaves using Wizard Genomic DNA Purification kit (Promega) and digested with methylation-sensitive restriction enzyme (MspI or CfoI ...
-
bioRxiv - Microbiology 2023Quote: ... UTI-59 DNA for long-read sequencing only was extracted using the Wizard HMW DNA Extraction Kit (Promega, USA) following the manufacturer’s instructions excepted eluted in molecular grade water ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid sequence was verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega).
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from FFPE samples (Discovery Cohort) using Maxwell 16 LEV RNA FFPE Kit (Promega, Madrid, Spain), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: NAD+ and NADH measurements were done with the NAD/NADH-Glo Assay Kit (#G9071 from Promega, Madison, WI, USA). Cells were grown in 24-well plates ...
-
bioRxiv - Developmental Biology 2023Quote: ... 293T cells were harvested and luciferase and renilla activities were detected using the Dual-luciferase reporter assay kit (Promega) in a Glowmax 20/20 luminometer (Promega) ...
-
bioRxiv - Genomics 2024Quote: ... The ground material was used for genomic DNA extraction with the RSC Plant DNA Kit (Promega, Madison, WI, USA) using the Maxwell® RSC device according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ATP levels in conditioned media and serum were measured by RealTime-Glo Extracellular ATP Assay kit (Promega, Madison, WI).
-
bioRxiv - Cell Biology 2024Quote: ... and equal amounts of RNA per sample were transcribed into cDNA using the GoScriptTM Reverse Transcription Kit (Promega #A5000). Quantitative PCR (qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... tumoral area was macrodissected prior DNA extraction using Maxwell 16 FFPE LEV DNA Purification Kit (Promega, Madison, WI, USA). DNA from the 60 non-CCHD carotid bodies were previously extracted and passed internal quality control at the VHIO’s laboratory before sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... Twenty-four hours after transfection cells were harvested for luciferase assay using the Dual-Glo Reporter Assay Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: The oxidized glutathione (GSSG) and reduced glutathione (GSH) were individually measured by employing the Glutathione Assay Kit (Promega, USA) as described by Nakagawa et al ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Females from each progeny were then pooled to perform genomic DNA extraction (Wizard® Genomic DNA Purification Kit, Promega) and subsequently do amplicon sequencing on the dsx target to check the frequency of the dsxFΔ11 allele in the offspring ...
-
bioRxiv - Cell Biology 2024Quote: ... we isolated individual clones and screened for expression using the C-terminal nanoluc fusion (Nanoluc Lytic Detection Kit, Promega), followed by additional characterization of SMO agonist-induced ciliary accumulation via microscopy ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The plasmid DNA was purified from 4-mL overnight cultures by use of the Wizard Plus MiniPrep kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... cell supernatants were harvested for RNA extraction with a Maxwell RSV Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI). Then ...
-
bioRxiv - Biophysics 2021Quote: HEK293T cells were collected and pelleted 72 hr post-transfection for genomic DNA extraction using the Wizard Genomic DNA Purification Kit (Promega). The target locus was PCR-amplified using AccuPrime Pfx high-fidelity DNA polymerase (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting libraries were checked for their quality using the High-sensitivity DNA chip using the Agilent 2100 Bioanalyzer (Waldbroon, Germany) and quantified using the QuantiFluor One dsDNA kit (Promega). Paired-end (2x300bp ...
-
bioRxiv - Cell Biology 2019Quote: ... to oxidized NAD (NAD+) ratio was determined in hMPCs via a commercially available luminescence-based kit (NAD/NADH GloTM Assay, Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and individual colonies were inoculated in Luria-Bertani (LB) media for DNA extraction using DNA miniprep or midiprep kits (Promega). All mutations were verified by Sanger DNA sequencing (Stony Brook University Genomic Facility) ...
-
bioRxiv - Cell Biology 2020Quote: ... proteins were produced from pcDNA3-based plasmids at 30 °C for 90 min using the in vitro transcription & translation (IVTT) kit (Promega), following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... Total cell and mitochondrial free cholesterol and cholesterol ester contents were measured using the Cholesterol/Cholesterol Ester-Glo Assay Kit (J3190, Promega) according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: Pooled DNA extractions (minimum 90 adult mosquitoes or 3500 L1 larvae) were performed using the Wizard Genomic DNA Purification kit (Promega). A 349 bp locus containing the predicted on-target cleavage site was amplified with primers containing Illumina Nextera Transposase adapters (underlined) ...
-
bioRxiv - Microbiology 2019Quote: ... The viability of N2a cells was evaluated by Cell Titer 96 AQueous One Solution cell proliferation assay kits (Promega, G3582) according to the manufacturer’s instruction.
-
bioRxiv - Molecular Biology 2021Quote: After 24 hours a luciferase assay was performed according to the instructions of the Dual-Luciferase Reporter Assay System kit (Promega) or the cells were resuspended in TRI Reagent (Sigma-Aldrich).
-
bioRxiv - Microbiology 2020Quote: ... Overnight cultures were used for genomic DNA (gDNA) preparation using Promega Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) or Epicenter MasterPure Complete DNA and RNA Purification Kit (Lucigen ...
-
bioRxiv - Genetics 2022Quote: ... instrument was configured with the Standard Elution Volume (SEV) hardware and using the Maxwell 16 Cell DNA purification kit (Promega). For total RNA isolation ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then pelleted at 300g for 7 minutes and resuspended in 200μL of Homogenization Buffer from the Maxwell RSC simplyRNA Tissue Kit (Promega #AS1340). Cells were then lysed by adding 200μL of lysis buffer and transferred into the Maxwell RSC Cartridge ...
-
bioRxiv - Molecular Biology 2021Quote: Agonist (α-MSH, afamelanotide, bremelanotide or THIQ) stimulated cAMP accumulation was measured by a GloSensor™ cAMP assay kit (Promega). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mammalian expression vectors for EphA1 WT and EphA1 P460L were transfected into HEK cells using Fugene6 transfection kit (Promega). Expression of EphA1 WT or EphA1 P460L was confirmed by immunoblotting with anti-Flag or anti-Myc antibody.
-
bioRxiv - Molecular Biology 2020Quote: Preserved tissue (10-15 mg) was used for nucleic acid purification by employing the Wizard genomic DNA kit (Promega, USA) and following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... then 1 µg RNA was used to synthesize the oligo(dT) primed first-strand cDNA using the M-MLV reverse transcriptase cDNA synthesis kit (Promega). Quantitative RT-PCR was performed using a CFX96 Real-Time PCR detection system (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the relative rDNA promoter activity was measured in cell lysates using a dual luciferase assay kit (https://worldwide.promega.com/products/luciferase-assays/reporter-assays/dual_luciferase-reporter-assay-system/?catNum=E1910, Promega, Madison, WI, USA).
-
bioRxiv - Molecular Biology 2021Quote: The ATP quantification assay was performed as per the protocol for the CellTiter-Glo 3D cell viability assay kit (Promega), using 1x 104 cells per sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... the two blots were hybridized O/N at 65 °C to each their radioactively labeled 3’ CF probe (AGO1 3’ CF and CSD2 3’ CF probes labelled with Prime-a-gene labeling kit from Promega). The membranes were washed 3 times in 2xSSC (0.3 M NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... cell viability was assessed by measruring ATP levels in cells lysates with a commercially available kit (CellTiter-Glo®, Promega).
-
bioRxiv - Microbiology 2020Quote: ... Transduction rates were assessed by measuring luciferase activity in cell lysates at 48 hours post transduction with a commercially available kit (Promega). Values for untreated controls were set to 100% infection.
-
bioRxiv - Microbiology 2020Quote: ... Infection rates were assessed by measuring luciferase activity in cell lysates at 16 h post transduction with a commercially available kit (Promega). Values for untreated controls were set to 100% infection.
-
bioRxiv - Genomics 2020Quote: ... of blood sample was collected from each individual and genomic DNA was extracted by using Maxwell RSC whole blood DNA extraction kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Genomic DNA was extracted from selected clones as well as in the parental clone using the Wizard Genomic DNA Purification Kit (Promega). NGS was performed using Nextera XT DNA Library Preparation kit and the NextSeq 500 sequencing systems (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... After 48 h Luciferase assay was performed according to manufacturers’ instruction using the Dual-Luciferase Reporter Assay System Kit (Promega).