Labshake search
Citations for Promega :
4551 - 4600 of 5396 citations for Rat Protein Glutamine Gamma Glutamyltransferase 2 TGM2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... [32P]-dCTP labelled hmbA and 18S rRNA gene-specific DNA molecules were used as gene probes using the random hexanucleotide-primer kit following the supplier’s instructions (Promega). As a loading control ...
-
bioRxiv - Microbiology 2022Quote: ... PPMP was assessed for cytotoxicity at the indicated concentrations with a CytoTox96 non-radioactive cytotoxicity colorimetric assay kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total RNA was extracted from 293T cells using an Eastep Super Total RNA Extraction Kit (LS1040, Promega, WI, USA). Reverse transcription was conducted using GoScriptTM Reverse Transcription Mix and Random Primers (A2800 ...
-
bioRxiv - Immunology 2022Quote: ... the samples were thawed and aliquoted in technical duplicates for detection of firefly and renilla luciferase activity using the Dual-Luciferase Reporter Assay kit using the GloMax luminometer to the manufacturer’s specifications (Promega). Promoter activity was determined by normalising firefly luciferase values to renilla luciferase values and expressed as relative light units (RLU).
-
bioRxiv - Microbiology 2022Quote: PCR amplicons were gel extracted using the QIAquick gel extraction kit and ligated into pGEM-T Easy plasmid (Promega). Vectors containing the PCR products were then cloned into chemically competent E ...
-
bioRxiv - Neuroscience 2023Quote: ... the luminescence detection assay was performed following all the manufacturer’s recommendations (Dual-Luciferase Reporter Assay Kit System E1910 (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... The ATP concentration was measured using an ENLITEN ATP Assay System with a bioluminescence detection kit (Promega, Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... 1 mL of cells was then processed using the Promega Wizard® genomic DNA preparation kit (Promega, WI, USA) to obtain genomic DNA ...
-
Throat colour polymorphism in relation to sex and body size of the Litter skink, Lankascincus fallaxbioRxiv - Zoology 2022Quote: ... black and white throat colored individuals using Promega Wizard® genomic DNA purification kit (Promega Corporation, Madison, Wisconsin, USA) following manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2024Quote: ... Viability of MV-4-11 cells was assessed using the CellTiterGlo 2.0 kit from Promega (as per manufacturer instructions); viability of HPAFII cells was assessed using PrestoBlue reagent from Thermo Fisher (as per manufacturer instructions) ...
-
bioRxiv - Bioengineering 2024Quote: ... organoid viability was measured by using a luminescence-based CellTiter-Glo 3D® cell viability assay kit (G9681, Promega) and recording luminescence intensity with a microtiter well plate reader (BioTek® Cytation 5).
-
bioRxiv - Bioengineering 2024Quote: The viability of cells was analyzed by using the CellTiter-Glo® 3D cell viability assay kit (Promega; G9681) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2023Quote: ... Renilla luciferase internal control vector pRL-TK and the dual luciferase reporter assay kit were from Promega (Madison, WI). Phusion PCR enzyme ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were harvested by centrifugation and lysed with the Passive Lysis Buffer of the Dual-Luciferase detection kit (Promega). 10 µl cell extract was mixed with an equal volume of firefly luciferase assay substrate from the kit ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA (1000ng input) was subsequently reverse-transcribed to cDNA using random primers and the GoScript reverse transcriptase kit (Promega). RT-qPCR was performed using FIREPoly qPCR Master Mix (Solis BioDyne ...
-
bioRxiv - Neuroscience 2024Quote: ... Blood and iPSC genomic DNA were extracted through Promega Wizard™ Genomic DNA Purification Kits (Promega, Madison, WI, USA). Array comparative genome hybridisation (array-CGH ...
-
Identification of echinacoside as a tobramycin potentiator against Pseudomonas aeruginosa aggregatesbioRxiv - Microbiology 2024Quote: Genomic DNA from different isolates was obtained from pelleted overnight cultures using the Wizard Genomic DNA purification kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: DNA purification from agarose gel was done using Wizard SV Gel and PCR Clean-Up System Kit from Promega as per manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2024Quote: DNA purification from PCR mixture was done using Wizard SV Gel and PCR Clean-Up System Kit from Promega as per manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2023Quote: ... 293T cells were harvested and luciferase and renilla activities were detected using the Dual-luciferase reporter assay kit (Promega) in a Glowmax 20/20 luminometer (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... lactate dehydrogenase (LDH) was measured from leukocyte supernatants using CytoTox 96 Non-Radioactive Cytotoxicity kit (Promega; Cat. No. g1780) per manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... lactis CICC 6242 strain producing nisin A was extracted using a “Wizard Genomic DNA Purification” kit (Promega, Madison, USA). The nisA and nisRK genes were amplified through a polymerase chain reaction using the primers listed in Table 1 [29] ...
-
bioRxiv - Microbiology 2022Quote: The HEV replicon plasmids were linearised with BglII before being used to generate T7 in vitro transcribed RNA using the HiScribe T7 ARCA mRNA kit with tailing following manufacturer’s instructions (Promega). RNA was purified using an RNA clean and concentrate kit (Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... Sequences of all plasmids were verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Cat# 063001) with a Spectrum Compact CE System (Promega). The psPAX2-IN/HiBiT plasmid was a kind gift from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... RNA extraction was performed with the Maxwell RSC PureFood GMO and Authentication kit using a Maxwell RSC instrument (Promega France ...
-
bioRxiv - Microbiology 2022Quote: pSK-E2-nLuc replicon plasmid was linearised with BglII and pUC-HEV83-2 replicon plasmid was linearised with HindIII before being used to generate T7 in vitro transcribed RNA using the HiScribe T7 ARCA mRNA kit with tailing following manufacturer’s instructions (Promega). RNA was purified using an RNA clean and concentrate kit (Zymo Research ...
-
bioRxiv - Cancer Biology 2023Quote: Monitoring cell viability in real time was performed by the RealTime-Glo MT Cell viability assay kit (Promega, G9713) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Amount of ATP release in response to compound were measured by Celltiter-Glo 2.0 cell viability assay kit (Promega) as per the manufactures’ protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was determined using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (MTS) kit (Cat. #G3580, Promega). All experiments were performed in biological triplicates.
-
bioRxiv - Biochemistry 2023Quote: ... Luminescence values were normalized by amount of live cells in vehicle control-treated wells (CellTiter-Glo 2.0 Assay Kit, Promega). CTG reagent was added to vehicle control-treated wells in triplicate 15 min after addition of the cAMP-glo Max Assay kit ONE buffer.
-
bioRxiv - Microbiology 2023Quote: The potential for M2e-specific antibodies to induce ADCC was evaluated using a mouse FcγRIV ADCC Reporter kit (Promega). In brief ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Cancer Biology 2023Quote: Total cholesterol and triglycerides from cells were determined by using Cholesterol/Cholesterol Ester-GlowTM assay kit (Promega, Madison, WI) and Triglyceride-GlowTM assay kit (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... The number of viable cells was determined using CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega G3580) and absorbance at 490 nm was measured by a plate reader (CLARIOstar ...
-
bioRxiv - Genomics 2023Quote: ... Protocol for cell lysis and measurement of the activities of the firefly luciferase (Dual-Luciferase Reporter Assay kit, Promega), with normalisation using the Renilla luciferase activity ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were collected for a luciferase activity assay using a dual-luciferase assay kit (Promega, Madison, WI, USA). The normalized luciferase activity was obtained by using the formula ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Total RNA was extracted using the Maxwell® RSC instrument together with the Maxwell® simplyRNA Tissue Kit (Promega) according to the manufacturer’s instructions with a final elution volume of 60 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... lactate dehydrogenase (LDH) release assay was performed using CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega, Madison, Wisconsin, USA) according to manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2023Quote: ... All mRNAs were prepared using the Ambion mMessage Machine kit using Sp6 (#AM1340) supplemented with RNAse Inhibitor (Promega #N251B).
-
bioRxiv - Developmental Biology 2023Quote: ... Ghost Database KY21.Chr1.1715) we extracted genomic DNA from local Norwegian animals using the Wizard Genomic DNA Purification Kit (A1120, Promega). We then used the purified gDNA at a concentration of 100-150ng/μl ...
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed on the plate and incubated with luminescence glo regents per the luminescence glo assay kit’s instructions (Promega). Luminescence was recorded using a BioTek Synergy2 plate reader.
-
bioRxiv - Cell Biology 2023Quote: DNA was prepared from bacterial cultures grown at 37°C using a Midiprep kit (PureYield Plasmid Midiprep System, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: The intracellular NAD+ in 3T3-L1 cells or ASCs was measured using the NAD+/NADH-Glo assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 ng of total RNA was transcribed to cDNA using the ImProm-II™ reverse transcription kit (Promega, A3500) with random primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Renilla and Firefly luciferase activities were measured on a luminometer using the Promega dual luciferase kit (Promega, E1910) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was determined using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (MTS) kit (Cat. #G3580, Promega) at 24 ...
-
bioRxiv - Genetics 2023Quote: ... RNA (1000 ng input) was subsequently reverse-transcribed to cDNA using random primers and the GoScript RT kit (Promega). RT-qPCR was performed using FIREPoly qPCR Master Mix (Solis BioDyne ...
-
bioRxiv - Genomics 2023Quote: ... The total cellular DNAs of the activated CD4+ T cells were isolated using a DNA extraction kit (Promega Wizard) for analysis.
-
bioRxiv - Microbiology 2023Quote: ... Total genomic DNA was isolated from overnight cultures of Ag1 and Ag2 using the Genome Wizard kit (Promega, WI), following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... cells were collected to measure the firefly luciferase and renilla luciferase luminescent activities using the Dual-Luciferase Reporter Assay kit (Catalog:E1910, Promega) with 96-well plates (Nunc MaxiSorp ...