Labshake search
Citations for Promega :
4501 - 4550 of 6667 citations for Osteopontin Human OPN ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 400 ng of total RNA was transcribed to cDNA using the ImProm-II™ reverse transcription kit (Promega, A3500) with random primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Renilla and Firefly luciferase activities were measured on a luminometer using the Promega dual luciferase kit (Promega, E1910) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was determined using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (MTS) kit (Cat. #G3580, Promega) at 24 ...
-
bioRxiv - Genetics 2023Quote: ... RNA (1000 ng input) was subsequently reverse-transcribed to cDNA using random primers and the GoScript RT kit (Promega). RT-qPCR was performed using FIREPoly qPCR Master Mix (Solis BioDyne ...
-
bioRxiv - Genomics 2023Quote: ... Protein was precipitated by the addition of 200 μl Protein Precipitation Solution (Promega Wizard HMW DNA Extraction Kit A2920). Using a wide bore tip the samples were mixed by drawing up contents from the bottom of the tube and then expelled on the side of the tube 5 times ...
-
bioRxiv - Genomics 2023Quote: ... The total cellular DNAs of the activated CD4+ T cells were isolated using a DNA extraction kit (Promega Wizard) for analysis.
-
bioRxiv - Microbiology 2023Quote: ... Total genomic DNA was isolated from overnight cultures of Ag1 and Ag2 using the Genome Wizard kit (Promega, WI), following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... cells were collected to measure the firefly luciferase and renilla luciferase luminescent activities using the Dual-Luciferase Reporter Assay kit (Catalog:E1910, Promega) with 96-well plates (Nunc MaxiSorp ...
-
bioRxiv - Microbiology 2023Quote: ... The sequence of the plasmid was verified by sequencing using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega). To generate a pDON-5 Neo-vector expressing IFNAR1 with the W70C mutation ...
-
bioRxiv - Cancer Biology 2023Quote: Total cholesterol and triglycerides from cells were determined by using Cholesterol/Cholesterol Ester-GlowTM assay kit (Promega, Madison, WI) and Triglyceride-GlowTM assay kit (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 25 µl of CellTiter-Glo® reagent from CellTiter-Glo® luminescent cell viability assay kit (Promega, Southampton, UK) was added to each well and mixed for 2 minutes on a plate shaker and incubated at room temperature (RT ...
-
bioRxiv - Neuroscience 2023Quote: RNA from lyophilized cerebrum and brainstem samples was extracted using the Maxwell® RSC simplyRNA Tissue Kit/Instrument (Promega) with initial homogenization on a TissueLyser LT (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Caspase CP and CAEC apoptosis was determined after treatment with hemin or vehicle using a Caspase glo kit (Promega) according to manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA (1-2 μg) was reverse transcribed with a GoScriptTM Reverse Transcriptase cDNA reverse transcription kit according to the manufacturer’s instructions (Promega Corporation ...
-
bioRxiv - Genomics 2023Quote: ... DNA of plant selected at this stage was extracted from rosette leaves using Wizard Genomic DNA Purification kit (Promega) and digested with methylation-sensitive restriction enzyme (MspI or CfoI ...
-
bioRxiv - Microbiology 2023Quote: ... UTI-59 DNA for long-read sequencing only was extracted using the Wizard HMW DNA Extraction Kit (Promega, USA) following the manufacturer’s instructions excepted eluted in molecular grade water ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid sequence was verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega).
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from FFPE samples (Discovery Cohort) using Maxwell 16 LEV RNA FFPE Kit (Promega, Madrid, Spain), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: NAD+ and NADH measurements were done with the NAD/NADH-Glo Assay Kit (#G9071 from Promega, Madison, WI, USA). Cells were grown in 24-well plates ...
-
bioRxiv - Developmental Biology 2023Quote: ... 293T cells were harvested and luciferase and renilla activities were detected using the Dual-luciferase reporter assay kit (Promega) in a Glowmax 20/20 luminometer (Promega) ...
-
bioRxiv - Genomics 2024Quote: ... The ground material was used for genomic DNA extraction with the RSC Plant DNA Kit (Promega, Madison, WI, USA) using the Maxwell® RSC device according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ATP levels in conditioned media and serum were measured by RealTime-Glo Extracellular ATP Assay kit (Promega, Madison, WI).
-
bioRxiv - Cell Biology 2024Quote: ... and equal amounts of RNA per sample were transcribed into cDNA using the GoScriptTM Reverse Transcription Kit (Promega #A5000). Quantitative PCR (qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... tumoral area was macrodissected prior DNA extraction using Maxwell 16 FFPE LEV DNA Purification Kit (Promega, Madison, WI, USA). DNA from the 60 non-CCHD carotid bodies were previously extracted and passed internal quality control at the VHIO’s laboratory before sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... Twenty-four hours after transfection cells were harvested for luciferase assay using the Dual-Glo Reporter Assay Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: The oxidized glutathione (GSSG) and reduced glutathione (GSH) were individually measured by employing the Glutathione Assay Kit (Promega, USA) as described by Nakagawa et al ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Females from each progeny were then pooled to perform genomic DNA extraction (Wizard® Genomic DNA Purification Kit, Promega) and subsequently do amplicon sequencing on the dsx target to check the frequency of the dsxFΔ11 allele in the offspring ...
-
bioRxiv - Cell Biology 2024Quote: ... we isolated individual clones and screened for expression using the C-terminal nanoluc fusion (Nanoluc Lytic Detection Kit, Promega), followed by additional characterization of SMO agonist-induced ciliary accumulation via microscopy ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The plasmid DNA was purified from 4-mL overnight cultures by use of the Wizard Plus MiniPrep kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The RNA (1 µg) was treated with RQ1 RNase-free DNase (Promega, WI) and then reverse-transcribed using High-Capacity cDNA RT kit (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... cells were washed 1 × with PBS and lysed with Cell Lysis Buffer (Promega) at RT for 20min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were then lysed in 100 μl of 1× Passive Lysis Buffer (Promega) and luciferase activity in 10 μl aliquots of the cell lysates was measured using the Dual Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1 GFP-Sec61β stable cell line was generated by Fugene-HD (Promega) transfection of pAc-GFPC1-Sec61β ...
-
bioRxiv - Neuroscience 2021Quote: ... Further overnight digestion was carried out with 1:20 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 ng/well pGL4.74 plasmid (Luc2P/hRluc/TK, control luciferase reporter plasmid, Promega), and 100 ng/well of SMAD2/3 responsive reporter plasmid pGL4.48 (luc2P/SBE ...
-
bioRxiv - Molecular Biology 2021Quote: ... An anti-mouse IgG-horseradish peroxidase (HRP) conjugate (1:4000 Promega, Fitchburg, USA) was used as secondary antibody ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were washed with PBS and lysed with 1× passive lysis buffer (Promega). The Dual-Luciferase Reporter Assay System and GLOMAX (both Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were washed with PBS and lysed with 1× passive lysis buffer (Promega). Luciferase assay reagent and GLOMAX (both Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... primers (Supplementary Table 1) and GoTaq® G2 Flexi DNA polymerase (M7801, Promega). Resulting PCR products were purified on columns (Isolate II PCR Kit (BIO-52059 ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were digested overnight at 37 °C with 1 μg of trypsin (Promega). Subsequently ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... approximately 5.2 µg of purified gDNA (spiked with 1% unmethylated lambda DNA, Promega) was sheared into fragment size of 200-300 bp using Covaris S220 ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were digested overnight at 37°C with 1 µg of LysC (Promega) 38 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg RNA was reverse transcribed using GoScript Reverse Transcription Mix (A2790, Promega,) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... at a ratio of 11:18:1 using FuGENE HD transfection reagent (Promega). Forty-two hours after transfection ...
-
bioRxiv - Immunology 2020Quote: ... 1:3,000 dilution of HRP-conjugated anti-mouse IgG secondary antibody (W402B, Promega) was added and incubated for one additional hour ...
-
Vasohibin1, a new IRES trans-acting factor for sequential induction of angiogenic factors in hypoxiabioRxiv - Cell Biology 2019Quote: ... proteins from HL-1 cells were extracted with Passive Lysis Buffer (Promega France). Quantification of bioluminescence was performed with a luminometer (Centro LB960 ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were digested by adding sequencing grade trypsin (1:20 substrate:enzyme; Promega #5111) and incubating at 37°C for 16 h ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Cells were transfected with 1 µg DNA and 8 µl Fugene HD (Promega) in serum-free media (100 µL total volume) ...
-
bioRxiv - Immunology 2020Quote: ... The medium was supplemented with 1 mM beetle luciferin potassium salt solution (Promega) and bioluminescence assayed at room temperature using Varioskan Flash (Thermo Fischer).