Labshake search
Citations for Promega :
401 - 450 of 1080 citations for 7 Nitro 3 4 dihydro 2H benzo b oxepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl2 was added ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 ng/μL trypsin (Trypsin Gold, V5280, Promega, USA), 0.01 % enhancer (ProteaseMAX™ ...
-
bioRxiv - Cancer Biology 2023Quote: ... For the Caspase-Glo 3/6 Assay (Promega #G8092), Caspase-Glo 3/7 reagent was added to the cells ...
-
bioRxiv - Immunology 2024Quote: ... IVT mRNA (3 pmol) and 10U RNase inhibitor (Promega) were then added to the cell suspension ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... 5-GGATCCACACGGTGCAAAGAGAGACCC-3’ and 5′-TCGGCCTTTCAGACTAATCTTATCAGC-3’ The PCR products were gel purified and cloned into the pGEM-T vector (Promega; Madison, WI, USA). The inserted PCR fragments of individual clones were sequenced by Tsing KE Biological Technology ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then pelleted at 300g for 7 minutes and resuspended in 200μL of Homogenization Buffer from the Maxwell RSC simplyRNA Tissue Kit (Promega #AS1340). Cells were then lysed by adding 200μL of lysis buffer and transferred into the Maxwell RSC Cartridge ...
-
bioRxiv - Cancer Biology 2019Quote: ... Organoid viability was assessed at 7 days post-transfection using the CellTiter-Glo® Luminescent Cell Viability Assay kit (Promega), as per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... the whole lane was cut in 7 bands and digested, as described (Shevchenko et al, 1996) with sequencing-grade trypsin (Promega). For the ubiquitination analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... The sample was diluted 1:7 with 0.1 M NH4HCO3 before overnight digestion of proteins with trypsin (Promega, cat#V5113) at 30°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... the MCF-7 and MDA-MB-231 cells were infected with Plasmids expressing RFP or GFP using Fugene 6 (Promega) at an early passage and were selected using 2 μg/ml puromycin (Sigma).
-
bioRxiv - Cancer Biology 2021Quote: ... Cell number was measured after 3 and 7 days and normalized to the initial reading at day 0 using the CellTiter Glo Luminescent Cell Viability Assay (Promega). The experiments shown represent fold change at day 7 relative to day 0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and MCF-7/CA-IX cell lines by standard clonogenic stable cell construction procedures using Fugene HD (Promega, E 2311). The U2-OS and HEK-293 cells transfected with empty pCMV6 (PS10001 ...
-
bioRxiv - Developmental Biology 2023Quote: ... After 7 days of culture the MTS cell viability reagent (CellTiter 96® Aqueous One Solution Cell Proliferation Assay, Promega) was added and plates incubated for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... serum stimulation was done with DMEM containing 15 % FBS and cells were harvested after 7 h of stimulation and SRF reporter activity was measured with Dual-Luciferase reporter assay system (E1910; Promega) and a luminometer ...
-
bioRxiv - Cell Biology 2023Quote: ... Necrosis was quantified by measuring release of lactate dehydrogenase in 30 µl samples of the medium and apoptosis by determining cell-associated Caspase3/7 activity using the respective kits from Promega Corp. ...
-
bioRxiv - Microbiology 2021Quote: ... Digested protein suspensions with 4 μg trypsin (Promega) in 40 μL 25 mM NH4HCO3 buffer at 37 °C overnight ...
-
bioRxiv - Immunology 2021Quote: ... 4 U RNasin Ribonuclease Inhibitor (Promega, Cat#N2115), 6 U Recombinant RNase Inhibitor (Takara ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 4 μL of RQ1 DNase (Promega, M6101) were applied to the lysate and incubated at 37 °C for 3 min ...
-
bioRxiv - Microbiology 2019Quote: ... 3 μg of RNA was treated with DNase 1 (Promega) for 2 hours at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... we mixed 3 ng/μL of lambda DNA (D1501, Promega) and 5 nM of condensin in an Eppendorf tube for a 10 min incubation to induce condensin-DNA interaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell viability was measured 3 days later using CellTiterGlo (Promega).
-
bioRxiv - Microbiology 2021Quote: ... in a 3:1 ratio of FuGENE®HD (Promega) transfection reagent to DNA ...
-
bioRxiv - Immunology 2020Quote: ... the protein suspension was digested with 3 μg trypsin (Promega) in 40 μl 25 mM NH4HCO3 overnight at 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... (3) we used ProNex Size-Selection DNA purification System (Promega) for purification of PCR product ...
-
bioRxiv - Cancer Biology 2019Quote: ... cleaved caspase 3 was visualized with antibody (Promega Cat # G7481)) labeled with Qdot 655 Streptavidin conjugate (Thermo Cat# Q10121MP) ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... followed by 3 h at 37°C using trypsin (Promega). All proteolytic digests were acidified to pH 2 by addition of 10% formic acid and directly analyzed by LC-ESI-MS/MS ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... we utilized BetaFluor β-gal assay kit (Promega 70979-3) to distinguish between Kif17+/- and Kif17-/- littermates at postnatal day 8 ...
-
bioRxiv - Microbiology 2023Quote: ... the permeabilization protocol used a 3 minute 0,02% digitonin (Promega) exposure ...
-
bioRxiv - Cancer Biology 2023Quote: ... after which 3 μL of CellTiter-Glo reagent (Promega, G7572) was added to each well ...
-
bioRxiv - Immunology 2023Quote: ... Tissues were embedded in 3% low melting point agar (Promega). Formalin embedding ...
-
bioRxiv - Cell Biology 2023Quote: ... 2-3 µg bacmid DNA was transfected (FuGene HD, Promega) into 2 ml Sf9 cells plated at 0.5x106 cells/ml density in a 6-well plate and left to incubate for 5-7 days 27ºC without shaking ...
-
bioRxiv - Biochemistry 2021Quote: ... on-bead digestions were done with 2 µg LysC (Wako chemicals 125-05061) in 4 M urea and 4 µg trypsin (Promega ADV5113) in 1.2 M urea sequentially before quenching with 1% formic acid ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Cytochrome B was amplified from the same saliva sample in which DrDV-B was detected using primers Bat 05A and Bat 04A (45) and GoTaq Green Master Mix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Pre-B Cell viability was assessed using trypan blue dye exclusion test54 and the CellTiter-Glo® assay (Promega, G7570). For the CellTiter-Glo assay ...
-
bioRxiv - Immunology 2020Quote: The strategy for genome-engineering to tag HLA-B with the HiBit peptide was developed based on a previous publication from Promega Corporation ...
-
bioRxiv - Microbiology 2023Quote: ... Specific adapters 1 and 2 described in Table B were self-hybridized and then ligated to the ‘A’ tail ends by T4 ligase (Promega). After purification with AMPure XP purification kit (Agencourt) ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μL of CellTiter-Glo® (Promega cat#: G7570) were added to each well and incubated for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 mM isopropyl β-d-1-thiogalactopyranoside (IPTG; Promega) was added to each RNAi well for induction of dsRNA synthesis and plates were incubated for 3-4 hours at 30°C and 155 rpm ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Samples were washed and endogenous biotin was blocked using Avidin/Biotin blocking kit (Vector laboratories ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...