Labshake search
Citations for Promega :
651 - 700 of 1080 citations for 7 Nitro 3 4 dihydro 2H benzo b oxepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Cells were then incubated overnight at 4 °C with anti-p75NTR (Promega; G323A; 1:300) and anti-TRADD (Santa Cruz ...
-
bioRxiv - Cell Biology 2020Quote: ... Cultures were then incubated overnight at 4°C with either anti-β3-tubulin (Promega #G712A) or anti-Oct4 (Santa Cruz Biotechnologies #SC-5279 ...
-
bioRxiv - Cell Biology 2021Quote: ... Neurons were then incubated overnight at 4° C with anti-p75NTR (Promega; G323A; 1:500) and anti-TRAF6 (Santa Cruz ...
-
bioRxiv - Microbiology 2021Quote: ... 4°C) and then resuspended in 100 µl 1 x Passive Lysis Buffer (PLB, Promega). 45 µl of the luciferase assay substrate dissolved in Luciferase Assay Buffer II was plated on a 96-well plate and 10 µl of the cell lysate was added immediately before measurement of Fluc activity using a Tecan reader ...
-
bioRxiv - Systems Biology 2019Quote: ... samples were diluted with 4 volumes of Digestion Buffer (50 mM NH4HCO3) and trypsin (Promega) was added at a ratio of 1:50 ...
-
bioRxiv - Systems Biology 2019Quote: ... samples were diluted with 4 volumes of Digestion Buffer (50 mM NH4HCO3) and trypsin (Promega) was added at a ratio of 1:50 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were digested using 4 μg of trypsin (sequencing grade, low autolysis trypsin; Promega), at 37 °C for 16 h ...
-
bioRxiv - Genetics 2022Quote: ... cells were transfected with L1 reporter constructs using 4 μl FuGENE HD transfection reagent (Promega), 96 μl Opti-MEM (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... Compound treatment was initiated 1-4 hours before transfections with FuGENE HD transfection reagent (Promega) following the manual ...
-
bioRxiv - Microbiology 2023Quote: ... 200 ml of media was treated with 4 U of RQ1 RNase-free DNase (Promega) for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Fisher) containing 4% FBS with or without HaloTag NanoBRET 618 Ligand (Cat. No. PRN1662, Promega) and incubated overnight at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The pellet was resuspended in 4 M urea containing 0.1 % Protease Max (Promega Corp. V2071) and diluted in 40 mM ammonium bicarbonate buffer ...
-
HIVtat Alters Epithelial Differentiation State and Increases HPV16 Infectivity in Oral KeratinocytesbioRxiv - Microbiology 2023Quote: ... 200 ml of media was treated with 4 U of RQ1 RNase-free DNase (Promega) for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA (4 μg) was reverse-transcribed using oligo-dT and the Reverse Transcription System (Promega). cDNA samples were diluted 1:10 and 5 μl of each sample were used for PCR reactions (final volume of 20 μl ...
-
bioRxiv - Biochemistry 2023Quote: ... The pellet was resuspended in 4 M urea containing 0.1 % Protease Max (Promega Corp. V2071) and diluted in 40 mM ammonium bicarbonate buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 hours incubation at 37 °C) and 5 μg of trypsin (Trypsin Gold from Promega, in 50 mM TEAB pH 8.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega), after overnight transfection cells were grown in fresh medium for 6 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Genomics 2019Quote: ... Alternatively, ¼ of an agarose plug was soaked in GET solution (3% 2-mercaptoethanol, 0.5x QuantiFluor® dye (Promega), 1X TBE ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Microbiology 2020Quote: ... A DENV-1 3’UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was assayed with an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) colorimetric assay (Promega) per manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 3 µM PP242 for 2 h and lysed with Passive Lysis Buffer (Promega, E194A). Luminescence was detected with a Dual- Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with the Piggybac plasmid plus transposase at a 3:1 ratio using Fugene HD (Promega) and selected with G418 (300 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... Elution was conducted in 3 beads volume of proteasome buffer containing 1 μL of TEV protease (Promega, PRV6101) for 1 hr at 37°C.
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Systems Biology 2024Quote: ... followed by a 3:1 dilution with 100mM ammonium bicarbonate and addition of 2µg sequence-grade trypsin (Promega). Samples were digested at room temperature overnight and acidified with formic acid (final concentration 1%) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were examined for viability every 4 to 6 weeks with the CellTiter-Glo assay (Promega). Cell viability was measured in quadruplicates by seeding the cells (2,000 to 3,000 per well in 96-well plate) ...
-
bioRxiv - Cell Biology 2021Quote: ... for 4 h at 800 rpm and 42°C or thermolysine (1:50) (Promega, Walldorf, Germany) for 2 h at 800 rpm and 60°C ...
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µL of PBS containing 4 μg/mL Hoechst and 1/10000 CellTox Green Dye (Promega) were were dispensed per well 1 h prior to imaging at Cytation5 image cytometer or Opera Phenix (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2022Quote: ... and NUMB1-4 (from V.O.R.) expression plasmids was performed using FuGENE HD transfection reagent (Promega, E2311) according to the manufacturer’s protocol and selected with Geneticin (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viability was measured every 4 days using the CellTiter-Glo luminescent cell viability assay (Promega G7573). A D300e drug dispenser (Tecan ...
-
bioRxiv - Plant Biology 2022Quote: ... and GST- GBF3 were purified from 4 ml culture and immobilized on MagneGST Glutathione particles (Promega). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... then transfected with 4 μg pLZRS-GCaMP6 DNA plus 12 μl FuGENE 6 (Promega Cat. #E2691) in 800 μl of Opti-MEM (Thermo-Fisher Cat ...
-
bioRxiv - Microbiology 2023Quote: ... then digested with 4 μL of a trypsin/Lys-C Mix (0.5 μg/uL) (Promega # V5071) using a two-step in-solution digestion overnight at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... or MEK inhibitor U0126 (1, 10, and 50 µM for 4 h; Promega, Madison, WI, USA). A corresponding volume of dimethyl sulfoxide (Nacalai Tesque ...
-
bioRxiv - Biochemistry 2023Quote: ... HRP (4 μM) was added followed by 20 μL of Nano-glo luciferase substrate (Promega, N1110) to each well ...
-
bioRxiv - Cell Biology 2020Quote: ... the artificially synthesized PlGF 3’ untranslated regions (UTR) gene fragment was constructed into pMIR-reporter (Promega, Madison, WI, USA). A complementary sequence with mutation of the seed sequence was designed based on the wild type (WT ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System kit (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer with settings ...
-
bioRxiv - Molecular Biology 2020Quote: Gently re-suspend cells in 100 μl of 3% Glyoxal fixation solution with 1:25 RNasin Plus (Promega N261B) and incubate for 15 minutes on ice.
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was quantified to 3 μg to react 1 μg/μL random hexamer (C1181; Promega, Madison, WI, USA) at 70°C for 5 min ...
-
bioRxiv - Genomics 2020Quote: ... 3 ug of pCAG-NLS-Bxb1 was diluted in 250 uL of OptiMEM and 6 uL of Fugene (Promega). On day 2 ...