Labshake search
Citations for Promega :
351 - 400 of 1080 citations for 7 Nitro 3 4 dihydro 2H benzo b oxepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... cells were seeded on 24 mm glass coverslips and transfected with 2 µg plasmid DNA (1:1.3:3 ratio LAMP1:ER:opto-kinesin) and Fugene6 transfection reagent (Promega 1:3) for 20-30 h prior to imaging ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a total of 18 RNA extractions (3 morphs × 3 tissues × 2 biological replicates) were performed using the SV Total RNA Isolation System (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... and digested with 3 μg LysC (Wako) O/N at 37°C and then with 3 μg of trypsin (Promega) for eight hours at 37°C following FASP procedure (Filter-aided sample preparation 48) ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Initial P0 virus was obtained by addition of ∼3 µg recombinant bacmid DNA mixed with 3 µl FuGENE HD Transfection reagent (Promega) in 100 µl Sf900 II media (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3’-UTR derived from pNL1.1[Nluc] vector (Promega), and 50 nt poly(A ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Systems Biology 2020Quote: ... and T4 DNA ligase (3 U/μί, Promega) were applied to assemble all of the synthetic promoter blocks sequentially and simultaneously into the firefly reporter vector backbone in a one-pot reaction ...
-
bioRxiv - Neuroscience 2019Quote: ... organoids were embedded in 3% agarose (Promega, #V3125), sectioned at 120-µm thickness and collected in 30% sucrose in 1× PBS for cryopreservation ...
-
bioRxiv - Biochemistry 2021Quote: ... 1.8 nM 3 kb supercoiled pGEMT plasmid (Promega), and 20 nM MMTV intasomes in a final volume of 15 µL ...
-
bioRxiv - Zoology 2023Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was performed on the ViiA 7 Real-Time PCR System using GoTaq qPCR master mix (Promega) according to the manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... The mixture was then and incubated for 7min at 55°C followed by an additional 7 minute incubation with 3.5µl of SDS 0.2% (Promega, #V6551) to ensure that Tn5 was dissociated from the cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... ATP levels at day 0 and day 7 were measured using CellTiter-Glo Luminescent Cell Viability Assay (Promega). For analysis ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Immunology 2019Quote: ... NF-κB activity experiments were conducted using βTC3 cells transfected with 0.3 μg of the NF-κB.Luc reporter (Promega) and 0.25 μg CMV.β-galactosidase (a kind gift from Beth Israel Harvard Medical School ...
-
bioRxiv - Immunology 2023Quote: ... B lymphocyte proliferation was measured using the cell proliferation assay kit (CellTiter 96 Aqueous) from Promega (Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... or gels where Arm A and Arm B ran together) before staining with Diamond Nucleic Acid Stain (Promega) for 20 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 ng of Renilla (pRL-CMV, Promega), and 0.12 μL of X-tremeGENE HP ...
-
bioRxiv - Genetics 2022Quote: ... 4 units RQ1 RNase-free DNase (Promega), protease and phosphatase inhibitor mix (Halt ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 U RNaseIn plus Ribonuclease Inhibitor (Promega), 1 mM NaF and 100 µM luciferin (Promega)] to a final volume of 15 µl with water ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 4 μg/ml RNase A (Promega) for 10 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 µl of RQ DNAse I (Promega), 21 µl of nuclease-free water and 5 µl of CaCl2 (10mM ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 4 μL/well of Bright-Glo (Promega) was dispensed ...
-
bioRxiv - Genomics 2020Quote: ... 4 × Protease Inhibitor (Promega, Cat. No. G6521)] ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 or 4 (Promega Madison, WI, USA) (62) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4 U/μl reverse transcriptase (Promega). 2 µl of cDNA were used for Real-Time PCR with self-designed primers and SYBR green reaction (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4 µl 5x reaction buffer (Promega, M289A), 2.4 µl MgCl2 (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4 µl 5x reaction buffer (Promega, M289A), 2.4 µl MgCl2 (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 ng of Renilla control plasmid (Promega) and 0.62 μL of Lipofectamine 2000 Transfection Reagent (InvitrogenTM) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 4 μl of FuGENE 6 (Promega) in 100 μl of OPTI-DMEM ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Neuroscience 2021Quote: Neuronal transfections were performed on DIV 7 using a calcium phosphate kit (ProFection Mammalian Transfection System, Cat # E1200, Promega), based on a previously described method (Sando et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... For phospho-peptide samples the volume was increased to 2,000 μl (7-fold dilution) and 30 μg Trypsin Gold (Promega) was added to each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... selected fragments of alternatively spliced exons (Supplementary Table 7) were cloned into the pGEM®-T Easy Vector (Promega). To generate the DNA templates for transcription ...
-
bioRxiv - Immunology 2023Quote: Transient transfection was performed using 1 or 2 µg plasmid DNA and 3.5 or 7 µl FuGENE HD transfection reagent (Promega) per 5x 105 cells ...