Labshake search
Citations for Promega :
401 - 450 of 4050 citations for 5 Azepane 1 sulfonyl 2 methoxy benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: ... 2 µl trypsin (Promega Trypsin Gold) was added pre-diluted in ultra-pure water to 2 ng/µl and incubated overnight at 37°C in the thermal cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... The psiCHECK-2 vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3’ UTR vector were described before (Zhang et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl biotinylated Transcend tRNA (Promega) was included in the reaction mix resulting in biotinylation of lysine residues ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 U RNase-free DNase (Promega), 1 mM CaCl2 ...
-
bioRxiv - Genetics 2024Quote: The psi-CHEK-2 plasmid (Promega) was used for the luciferase assay ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 µl of the RT product (diluted 1:5) was used for semi-quantitative PCR or qPCR reactions with Promega PCR Mix (Promega, Madison, Wisconsin, USA) and SYBR Green PCR Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... followed by a reverse transcription using a universal degenerated oligo specific to all 5′ non-coding sequences of BTV-1 segments (BTV/Uni1; 5′ GTTAAAWHDB 3′) and the GoScript Reverse Transcription (RT) System (Promega, Madison, WI, USA). The cDNAs obtained for the segment 7 were then quantified with a real time quantitative PCR (qPCR) ...
-
bioRxiv - Microbiology 2021Quote: ... knowlesi elongation factor-1 alpha (pkef1-alpha) 5’ UTR were isolated from agarose gels and cloned into the pGEM-T vector (Promega, Madison, WI, USA). To replace the pfcam 5’ UTR sequence that drives luciferase transcription in the pD-pfcam-Luc ...
-
bioRxiv - Bioengineering 2023Quote: ... Reverse transcription was performed at 70 °C for 5 min and 42 °C for 60 min with 1 µg total RNA using ImProm-II reverse transcriptase (Promega, Madison, WI, USA) and 250 ng oligo(dT)12-18 primers (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
Spatial 3D genome organization controls the activity of bivalent chromatin during human neurogenesisbioRxiv - Neuroscience 2024Quote: ... Sorted nuclei were collected in 5-ml tubes containing 300-500 μl of collection buffer (PBS + 5% BSA) and RNasin Plus RNase inhibitor (Promega). Sorted nuclei were collected by centrifuging at 500g for 10 min at 4°C and processed for downstream analyses (RNA-seq ...
-
bioRxiv - Physiology 2024Quote: ... The locus containing the rdu14 allele was amplified by PCR, using the following primers (Forward: 5’-TGATTCACACTACTTACTTGTCTAG-3’, Reverse: 5’-GATTAAAAGTAGTTATCTCATCCTCAG-3’) and GoTaq polymerase (Promega, ). The genotype of the locus was scored after resolving samples on 2.5% agarose gels as HNF4α+/+ ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg RNA was incubated at 30 °C for 2 hr in Spodoptera frugiperda (Sf21) extract (Promega) in the presence of [35S]methionine-cysteine (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 20 ng/well of psiCHECK-2 plasmid (psiCHECK-2 Vector (V0) (Promega, C8021) or let-7a-mi6 targeting six regions of the 3ill UTR ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μl of DNase I (Promega, M6101) at 37 °C for 20 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng renilla control reporter vector (Promega), using TransIT-X2 transfection reagent (Mirus Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM DTT with sequencing-grade trypsin (Promega) for one hour at room temperature with 1:800 or 1:1600 mass (w/w ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 ng renilla control reporter vector (Promega), mock luciferase ...
-
bioRxiv - Genomics 2024Quote: ... lysed by a 5× reporter lysis buffer (Promega) and incubated overnight at −20°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µM HaloTag PEG-biotin ligand (G859A; Promega) or an equivalent amount of DMSO was added ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected according to manufacturer instruction with a transfection mix containing a ratio of 1 µg of plasmid for 2 µl FuGene HD transfection reagent (Promega, REF E2311) diluted in DMEM without FCS ...
-
bioRxiv - Molecular Biology 2021Quote: Melan-ink4a melanocytes were seeded on glass coverslips in 24-well plates at 3×104 cells/well and the day after were transfected with 1 μg of cDNA plasmid (Table S2) mixed with 2 μl of FuGENE6 (Promega, Madison, Wisconsin) in 500 μl Opti-MEM ...
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted to 2 M urea with 50 mM HEPES (pH 8.5) and proteolyzed with trypsin (Promega, 1:50 w/w) at room temperature overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... Columns were washed with 90% methanol/100 mM TEAB 10 times prior to on-column digestion with 1 ug Trypsin/Lys-C in 50 mM TEAB (47° C, 2 hours; Cat. #V5073, Promega, Madison, WI). The resulting peptides were eluted with sequential washes of 50 mM TEAB ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by sonication in the Bioruptor Plus sonication system and incubation with 1 μg of LysC and 2 μg of Trypsin (Promega Cat#V511A) at 37°C for overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... Japan) at 37 C for 2 h before digestion overnight with 1 ug Trypsin/Lys-C mix (V5071, Promega, Madison, WI, USA) at 37 C ...
-
bioRxiv - Genomics 2020Quote: RNA was isolated via acid-phenol extraction.72 RNA was DNase treated with RQ1 DNase (Promega M6101) by addition of 5µL RQ1 buffer and 5µL RQ1 DNase to each RNA sample ...
-
bioRxiv - Plant Biology 2022Quote: Glutathione and Ascorbic acid content were quantified using the GSH-GLO Glutathione Assay Kit (Promega, Madison, USA) and Megazyme kit (K-ASCO 04/19 ...
-
bioRxiv - Microbiology 2020Quote: Genomic deoxyribonucleic acid (gDNA) was isolated from each mutant using the Wizard® gDNA purification kit (Promega). Illumina NextSeq was then performed by the Genomic Services Facility at Indiana University Center for Genomics and Bioinformatics ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was extracted using the Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Cat# AS1330, Promega) or Maxwell® RSC miRNA from Plasma or Serum (Cat# AS1680 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary HRP-conjugated antibodies were added at a dilution of 1:10,000 in 5% milk in TBST and incubated for 60 minutes at room temperature (Anti-Mouse: Promega #W402B; Anti-Rabbit: Promega #W401B). The Pierce SuperSignal West Pico PLUS chemiluminescent substrate (Thermo Scientific #34577 ...