Labshake search
Citations for Promega :
451 - 500 of 4050 citations for 5 Azepane 1 sulfonyl 2 methoxy benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Genomics 2024Quote: ... extracted from 5 HPVL and 5 LPVL (Table S3, Petersen et al., 2021) were treated with the DNase RQ1 (Promega, US). Then ...
-
bioRxiv - Cell Biology 2022Quote: ... β-arrestin 2 fused at the N-terminus to LgBiT (LgBiT-β-arrestin 2; Promega, plasmid no. CS1603B118) was chosen as it has previously been used successfully with other class B GPCRs ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl ViaFect™ (Promega, Madison, WI) and 40 µl Gibco Opti-MEM reduced serum media (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: The psiCHECK-2 vector (Promega, Cat #C8021) was used to construct plasmids for dual-luciferase reporter assay ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mg/ml proteinase K (Promega, v3021)) at 37 °C overnight followed by addition of 10 μl of 3M potassium acetate and incubation at room temperature for 1h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µg of sequencing grade Trypsin (Promega) was added ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 μL RNasin RNase inhibitor (Promega). The transcription reaction was incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μg Sequencing Grade Trypsin (Promega). The beads were shaken overnight at 37 °C and pelleted by centrifugation (1,400 rcf ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 µg of sequencing grade trypsin (Promega) was then added to the samples and they were digested overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: The psiCHECK-2 control vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3′ UTR vector were described before26 ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µL dNTP (Promega U151B, 2.5 mM), 1.5 µL MgCl2 (25 mM) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 0.05 μg LgBiT-β-arrestin-2 (Promega) plus 0.9 µg pcDNA3.1 for 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μL of luciferin reagent (Promega BrightGlo) was added and luciferase activity detected (Perkin Elmer Envision) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 or 4 (Promega Madison, WI, USA) (62) ...
-
bioRxiv - Bioengineering 2022Quote: ... 2 U/µL RNasin Ribonuclease Inhibitor (Promega), 1.2 µM PrimeTime primers ...
-
Optimization and deoptimization of codons in SARS-CoV-2 and the implications for vaccine developmentbioRxiv - Evolutionary Biology 2022Quote: Dual-luciferase assay (psiCHECK-2 vector, Promega) was selected to analyze the effects of the viral mutation on protein synthesis ...
-
bioRxiv - Molecular Biology 2024Quote: ... and digested with 2 µg Trypsin (Promega) overnight at 37 °C shaking at 1200 RPM on a thermomixer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We then added 2 μg trypsin (Promega) in 100 mM TEABC and incubated overnight at 30 °C ...
-
bioRxiv - Microbiology 2023Quote: ... and 2× GoTaq qPCR Master Mix (Promega). qPCR was performed using the MyGo Pro real-time PCR instrument (IT-IS Life Science Ltd.) ...
-
bioRxiv - Immunology 2024Quote: ... psiCHECK-2 vector was purchased from Promega and the 3′-UTRs of Akt3 and Mapk3 were inserted between the XhoI and NotI sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 to 2 µg of RNA was used for DNase treatment as per the protocol provided by the manufacturer (Promega, Madison, Wisconsin, USA). This was followed by cDNA synthesis using reverse transcriptase kits from Applied Biosystems (High capacity cDNA synthesis kit ...
-
bioRxiv - Microbiology 2021Quote: ... The protein solution was further diluted down to less than 2 M urea with 50 mM Tris-Cl (pH 8) and incubated with 2 μg of modified trypsin (w/w, 1∶50) (Promega, Madison, WI, USA) at 37°C overnight ...
-
bioRxiv - Systems Biology 2024Quote: ... the samples were diluted with 50 mM HEPES (pH 8.5) to reduce urea concentration to 2 M and further digested overnight with trypsin (Promega, 1:50 w/w) at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... membranes were washed 3 times for 5 minutes in TBST or TBST-XL for mucin-2 and incubated with anti-mouse IgG HRP Conjugate (1:10000, Promega, Cat no. W4021) or anti-rabbit IgG HRP Conjugate (1:10000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... to a final urea concentration of 2 M for overnight Trypsin/Lys-C digestion at 35°C (1:50 protease:substrate ratio, Mass Spectrometry grade, Promega Corporation, Cat No: V5072).
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full-length fragment of human PFKFB3-5 was amplified with primers PFKFB3-5 reverse and PFKFB3-5 forward and subcloned into the plasmid pGEM-T using the T/A Cloning Kit (Promega, Mannheim, Germany). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... A fragment of the rat Piezo 1 cDNA was amplified with Taq Polymerase and the oligonucleotide primers 5’-GAGGAAGAGGACTACCTT and 5’-TTTACTTAGAAAACCCTACAG from bladder total RNA and cloned into the pGEM-T Easy vector (Promega, Madison, WI). Sequence was confirmed by Sanger capillary sequencing and sense and antisense RNA probes were synthesized with T7 and SP6 RNA polymerases (Roche-Sigma-Aldrich) ...
-
bioRxiv - Genomics 2020Quote: ... We removed RNA species in the nucleic acid via the addition of 4 μg of RNase A (Promega), and incubation at 37°C for 1 hour ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were digested by addition of 0.25 μg of sequencing grade trypsin dissolved in 50 mM acetic acid at 0.5 μg/mL (Promega) overnight at 37 °C with vigorous shaking ...
-
bioRxiv - Microbiology 2021Quote: Viral RNA was extracted from all samples using the Maxwell RSC Viral Total Nucleic Acid Purification Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... viral RNA was extracted from all samples using the Maxwell RSC Viral Total Nucleic Acid Purification Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated using the Viral Total Nucleic Acid kit for the Maxwell RSC instrument (Promega, Madison, WI) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... Human Gβ with a C-terminal 15-amino-acid polypeptide linker followed by a HiBiT (peptide 86, Promega) and human Gγ were cloned into pFastBac vector ...
-
bioRxiv - Cell Biology 2022Quote: ... Peptide solution was then acidified to 0.1% formic acid before adding 0.2 μg Mass Spec grade ProAlanase protease (Promega) and incubating at 37°C for a further 2 h ...
-
bioRxiv - Cell Biology 2022Quote: ... then alkylated with 1.9 mg/mL chloroacetic acid before proteolytic digestion with 0.2 μg sequencing grade ArgC (Promega) and incubation at 37°C for 16 h ...
-
bioRxiv - Biochemistry 2024Quote: ... or gels where Arm A and Arm B ran together) before staining with Diamond Nucleic Acid Stain (Promega) for 20 minutes ...
-
bioRxiv - Immunology 2020Quote: ... The following day cells were transfected with plasmids encoding for FLAG-tagged NLRP1 (2 μg) or the indicated DPP9 construct (2 µg) with FuGENE HD according to manufacturer’s instructions (Promega). Cells were harvested ...
-
bioRxiv - Molecular Biology 2023Quote: ... precipitated proteins were eluted by incubation of beads with Elution Buffer (2 M Urea, 50 mM Tris pH 7.5, 2 mM DTT, 20 µg/ml Trypsin Gold (Promega)) for 30 min at 37°C shaking at 1,400 rpm in the dark ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µL of 5X GoTaq Green Master Mix (Promega), 0.125 µL of 5u/µL GoTaq G2 polymerase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5 x 104 Jurkat effector cells (Promega # G701A) and serial dilutions of indicated human mAbs ...