Labshake search
Citations for Promega :
201 - 250 of 4050 citations for 5 Azepane 1 sulfonyl 2 methoxy benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL CellTiter-Flour (Promega) was added per well to measure cell viability and compounds toxicity ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 ng pRL-SV40 (Promega), and 375 ng total amount of testing plasmids individually or in combinations ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl H2O (Promega, P1199). Samples were incubated 1 hour at 56°C followed by 16 to 24 hours at 80°C and a holding step at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL Trypsin (Promega), 2 M urea ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of forward and reverse primer (5 μM, see Supplementary Table 1) and 5.5 μL of Nuclease-free Water (Promega). The PCR I was performed as follows ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was reduced with 5 mM DTT and alkylated with 14 mM iodoacetamide followed by digestion with trypsin (1:100, w:w) (Promega) as described in [80] ...
-
bioRxiv - Cell Biology 2021Quote: cDNA synthesis was performed using 1-5 μg of total RNA with random hexamers and reverse transcriptase (Promega, GoScript). Quantitative RT-QPCR was performed in triplicate for each samples using the KAPA SYBR PCR kit (Sigma Aldrich KK4600 ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were then diluted with water (1:5) and incubated overnight at 37°C with 0.5 µg of sequencing grade modified trypsin (Promega). Samples were acidified using 1% TFA and peptides separated into 3 fractions on a 200 µL StageTips packed with three Empore™ SPE Disks SDB-RPS (3M ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs], 0.5 µl RNasin [N2615, Promega GmbH] ...
-
bioRxiv - Neuroscience 2022Quote: ... 1–5 µl of gDNA was mixed with 0.5 µl of 10 mM dNTP mix (Promega, C1141, Madison, WI), 10 µl of 25 mM MgCl2 ...
-
bioRxiv - Immunology 2024Quote: ... plates were washed 5 times with wash buffer (PBS with 1% BSA (Capricorn Scientific) and 0.05% Tween-20 (Promega)) ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins were trypsinized on beads in 100 μL of digestion buffer (1 M urea, 50 mM Tris-HCl, pH 7.5, and 5 μg/mL trypsin (V5111, Promega)) ...
-
bioRxiv - Plant Biology 2021Quote: The optimised HaloTag®-7 sequence (298 amino acids) from Promega (https://www.promega.de/) was genetically split on position 155/156 aa into the N-terminal fragment “NHalo” (aa 1-155 ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by DNA staining with Diamond™ Nucleic Acid Dye (Promega, Madison, WI)
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 μl of premix [100 μM amino acid mixture without methionine (Promega), 100 μM amino acid mixture without leucine (Promega) ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was purified according to manufacturer instructions using phenol:chloroform nucleic acid extraction (Promega).
-
bioRxiv - Microbiology 2024Quote: ... or Maxwell 16 Viral Total Nucleic Acid Purification Kit (Promega Corporation, Madison, USA) for viral detection in cell culture supernatant ...
-
bioRxiv - Cell Biology 2020Quote: ... in pbs containing 5 mM glucose and supplemented with 5 µM of Nanoglo (Promega #N1120) or coelenterazine-H (Dalton #50909-86-9) ...
-
bioRxiv - Genomics 2024Quote: ... and MgCl2 (final 5 mM) and 5 units of RQ1 RNase-free DNase I (Promega) were added ...
-
bioRxiv - Cancer Biology 2022Quote: ... 20,000 to 50,000 cells were lysed in the transposase reaction mix (12.5 μl 2xTD buffer, 2 μl TDE1 [Illumina], 10.25 μl nuclease-free water, and 0.25 μl 1% digitonin [Promega]) for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were washed twice with 50 mM HEPES, pH 8.5 (18,000g, 2 x 10min) before they were incubated with 1 μg trypsin (Promega) in 50 mM HEPES ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were seeded in 96-well plates at 3,000-5,000/well in serial 1:2 dilutions for 72 hours and assessed by CellTiter-Glo (Promega). For synergy assays ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were digested overnight at 37 °C with 5 μL of trypsin (1 μg dissolved in 50 mM HEPES pH 8.0, Promega V5111). The trypsin digestion was quenched by adding 4 μL of 1× EDTA-free protease inhibitor cocktail (Roche 11873580001) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 μg of each protein was then boiled in PCR tubes at 100 °C for 5 min and allowed to cool to room temperature before 1 μg mass spectrometry-grade trypsin (Trypsin Gold from Promega) was added to each sample ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 pmols of folded pre-tRNA substrate was incubated with a final concentration of 5 U ml−1 RNasin plus inhibitor (Promega), 5 mM ATP and 8 pmols of TSEN complex in a final reaction volume of 20 μl for 1 h at 30 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were diluted with ddH2O 1:5 and proteins were digested for 20 h at 37°C using trypsin (Trypsin Gold, Promega) at an enzyme/protein ratio of 1:50 ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were washed with PBS-T 5 times and a 1:5000 dilution of HRP-conjugated goat anti-rabbit IgG antibody (Promega) was added for 45 min at 37 □ ...
-
bioRxiv - Cell Biology 2022Quote: Halo-MDC1 deletion mutants were expressed transiently by transfecting ∼ 5 × 105 cells with 1 µg of plasmid DNA using FuGene 6 (Promega). For genome editing ...
-
bioRxiv - Microbiology 2022Quote: ... between 0.5 to 1 µg of total RNA was reverse transcribed into cDNA using an ImProm II Reverse Transcriptase kit (Promega). Equal amounts of cDNA were quantified by RT-qPCR using the IQ SYBR green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were harvested day 1 and day 5 post-infection using a CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was co-transfected at a 1:5 ratio with either the HaloTag-ubiquitin plasmid (expressing Ub-Halo) or the HaloTag control (Promega). Transfected cells were incubated for 20 h at 37 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were diluted 5-fold with 25 mM Tris pH 8.0 and 1 mM CaCl2 prior to digesting them with trypsin (Promega, V511X) at a 1:30 enzyme-to-protein ratio at 37 °C in a dry bath for 16 h.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... with 10 ng pGL4.32[luc2P/NF-κB-RE/Hygro] (NF-κB response element-dependent firefly luciferase) or pGL4 [luc2P/AP-1-RE/Hygro] and 5 ng pRL-TK using the Dual Luciferase Reporter Assay (Promega). 24 hours post transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2022Quote: ... 1.7 μg of attB-hACE2-mNG2-1-10 plasmid or attB-S-mNG2-11 plasmid were added into 5 μL FuGENE 6 transfection reagent (Promega) and OptiMEM (Gibco ...
-
bioRxiv - Plant Biology 2022Quote: The dual luciferase assay (Figure 1 – figure supplement 5) was based on the Dual- Luciferase® reporter assay system (Promega). N ...
-
bioRxiv - Cell Biology 2024Quote: ... An amount corresponding to 5 % of the pull-down volume was saved for Western blot analyses and 1 µg of trypsin gold (Promega) was then added to the beads for 16 h at room temperature in a thermomixer at 600 RPM ...
-
bioRxiv - Microbiology 2024Quote: ... After three rounds of washing in PBST the following Horseradish peroxidase-conjugated secondary antibodies were diluted in 5% milk-PBST and used with at a 1:10000 dilution anti-rabbit (W4018, Promega), 1:5000 anti-mouse (W402B ...
-
bioRxiv - Biochemistry 2024Quote: ... then resuspended in 1 gel volume of 25 mM ABC containing 5 ng/µL of digestion grade trypsin (Promega, V5111) and incubated at 37°C for 16 hours for a full digestion or for 15 minutes for a partial digestion ...
-
bioRxiv - Biochemistry 2024Quote: ... and wild-type or mutant βarr1 with a C-terminal HA tag with a 1:5 DNA:FuGENE®6 (Promega) ratio according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM iodoacetamide (IAA) and proteins were eluted by digestion with 5 µg/ml trypsin (Promega). Eluted proteins were fully digested overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... Ethylenediaminetetra-acetic acid (EDTA, 0.5 M, pH 8.0) were purchased from Promega (Madison, WI). Lysyl endopeptidase (Lys-C ...
-
bioRxiv - Genomics 2021Quote: ... Total nucleic acid was then treated with DNase I as recommended (20 units; Promega), re-extracted with phenol/Sevag ...